AMCG00001043 (chn1,LOC107657347,LOC107742958,LOC107739458)


Basic Information

Item Value
gene id AMCG00001043
gene name chn1,LOC107657347,LOC107742958,LOC107739458
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 12789335 ~ 12795048 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001043
GTGGATAACCGGCCCAAATACTATGGCAGAGAGTACCATGGTATGATTTCAAGAGAAGAGACTGATCAGTTACTCAGTGTGGCCGAAGGGAGCTACCTCATCCGGGAGAGCCAGAGACAGCCTGGGACCTATACACTAGCCTTACGATTTGGAAACCAAACAAGAAACTTCCGCCTCTACTATGATGGAAAACACTTTGTCGGGGAAAAGCGTTTCGAGTCCATTCATGACCTGGTGACCGATGGACTGATCACCTTGTATATTGAGACCAAGGCTGCCGAGTACATTGCGAAGATGACAATCAACCCCATTTATGAGCACATAGGGTATACCACACTAAACCGGGAACCTGCACACAAGAAGTATGTGCCTGCCCTCAAAGATGTCCCTGATGGGAAAGAACCAGTGGCAGAGGATGCAAACTTGGAAGAGAGG

Function

symbol description
chn1 Enables GTPase activator activity and phorbol ester receptor activity. Acts upstream of or within oculomotor nerve formation and positive regulation of GTPase activity. Is expressed in several structures, including central nervous system; digestive system; integument; pharyngeal arch; and testis. Human ortholog(s) of this gene implicated in Duane retraction syndrome. Orthologous to human CHN1 (chimerin 1).

NR:

description
PREDICTED: N-chimaerin-like

GO:

id name namespace
GO:0005622 intracellular anatomical structure cellular_component
GO:0046872 metal ion binding molecular_function
GO:0001565 phorbol ester receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001043 True 435 mRNA 0.49 3 12789335 12795048

Neighbor

gene id symbol gene type direction distance location
AMCG00001044 chn1,LOC107588230,LOC107600702,LOC100196534,LOC106586243,LOC106581750 coding downstream 12322 12765659 ~ 12777013 (-)
AMCG00001038 chrna1,LOC106595477 coding downstream 28968 12752413 ~ 12760367 (-)
AMCG00001042 NA coding downstream 49871 12732619 ~ 12739464 (-)
AMCG00001040 NA coding downstream 67656 12705465 ~ 12721679 (-)
AMCG00001030 ola1,LOC105019904 coding downstream 109907 12676022 ~ 12679428 (-)
AMCG00001046 atf2,LOC107671311,LOC107739459 coding upstream 19393 12814441 ~ 12836485 (-)
AMCG00001045 atp5g3,LOC106590033,LOC105007245 coding upstream 42394 12837442 ~ 12841125 (-)
AMCG00001048 lnpb coding upstream 164894 12959942 ~ 12974186 (-)
AMCG00001051 evx2,evx2a,LOC107657379,LOC107671304 coding upstream 191987 12987035 ~ 12989882 (-)
AMCG00001059 NA coding upstream 418741 13213789 ~ 13224364 (-)
G128070 NA non-coding downstream 294120 12493178 ~ 12495215 (-)
G128045 NA non-coding downstream 401751 12358559 ~ 12387584 (-)
G127976 NA non-coding downstream 630852 12154508 ~ 12158483 (-)
G127899 NA non-coding downstream 877513 11908986 ~ 11911822 (-)
G127747 NA non-coding downstream 1171230 11615457 ~ 11618105 (-)
G128191 NA non-coding upstream 204534 12999582 ~ 12999876 (-)
G128212 NA non-coding upstream 270092 13065140 ~ 13070429 (-)
G128237 hnrnpa3 non-coding upstream 411826 13206874 ~ 13211855 (-)
G128242 NA non-coding upstream 452841 13247889 ~ 13280730 (-)
G128322 NA non-coding upstream 801737 13596785 ~ 13597366 (-)
G128160 wipf1 other downstream 37819 12732184 ~ 12751516 (-)
AMCG00001039 NA other downstream 56734 12725694 ~ 12732601 (-)
AMCG00001041 cir1,si:ch73-167c12.2 other downstream 85425 12697177 ~ 12703910 (-)
AMCG00000960 NA other downstream 2088971 10696856 ~ 10700364 (-)
G127443 NA other downstream 2511124 10274687 ~ 10278211 (-)
AMCG00001061 cycsb,LOC108273362,LOC108430847,LOC107740584 other upstream 561935 13356983 ~ 13359770 (-)
AMCG00001068 LOC107576050 other upstream 972493 13767541 ~ 13773878 (-)
G128628 NA other upstream 1797651 14592699 ~ 14598570 (-)
G128741 NA other upstream 2384193 15179241 ~ 15180322 (-)
AMCG00001118 hibch other upstream 2569019 15364067 ~ 15433469 (-)

Expression


Co-expression Network