G126621


Basic Information

Item Value
gene id G126621
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 5349982 ~ 5350242 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU158756
CAGGGTCTCGCACTCTTGGGTCTTTAAAGTCCACCTCCTTCAGGGCTTCCAGGTTGACCCTCACAATCACTTTCTTTGTCGCTGTACAGAATGACAGAAAGGCTCAGCTCAGCATTGCCATTTCACTATCCCCTCGATAAAGAGACAGGAGAGTGAAGGGCAGTGAGAGACAATAGTGACCTCGATGTGCAAAGTGAGAGAGATGCAGGTAAACTCAACCGATGTCCCATACCTGAGCCCTGCAGTGCGTTTGTCTGCGGG

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU158756 True 261 lncRNA 0.51 1 5349982 5350242

Neighbor

gene id symbol gene type direction distance location
AMCG00000845 NA coding upstream 17276 5316197 ~ 5332706 (+)
AMCG00000844 NA coding upstream 84277 5221997 ~ 5265705 (+)
AMCG00000841 adcy5,LOC107555914,LOC107660638,LOC107661140 coding upstream 233998 5081856 ~ 5115984 (+)
AMCG00000840 LOC107714401,LOC107596066,LOC107661140,LOC107555914,LOC107741932,LOC107660638 coding upstream 301898 5039948 ~ 5048084 (+)
AMCG00000837 LOC107580446 coding upstream 315285 5025295 ~ 5034697 (+)
AMCG00000849 NA coding downstream 47083 5397325 ~ 5404570 (+)
AMCG00000847 NA coding downstream 75919 5426161 ~ 5441254 (+)
AMCG00000857 NA coding downstream 122852 5473094 ~ 5487499 (+)
AMCG00000855 clasp1 coding downstream 147380 5497622 ~ 5556669 (+)
AMCG00000856 NA coding downstream 207209 5557451 ~ 5568381 (+)
G126574 NA non-coding upstream 217026 5132374 ~ 5132956 (+)
G126573 NA non-coding upstream 217991 5131718 ~ 5131991 (+)
G126572 sec22a non-coding upstream 219321 5128507 ~ 5130661 (+)
G126570 NA non-coding upstream 222326 5127314 ~ 5127656 (+)
G126569 NA non-coding upstream 223174 5126559 ~ 5126808 (+)
G126667 NA non-coding downstream 116740 5466982 ~ 5467528 (+)
G126697 NA non-coding downstream 219728 5569970 ~ 5571932 (+)
G126714 NA non-coding downstream 369026 5719268 ~ 5799635 (+)
G126781 map3k19,LOC106586307 non-coding downstream 850667 6200909 ~ 6201605 (+)
G126782 NA non-coding downstream 853456 6203698 ~ 6206033 (+)
AMCG00000734 NA other upstream 3535825 1805407 ~ 1814157 (+)
AMCG00000729 satb2,LOC107690605,LOC107569722 other upstream 3651409 1668845 ~ 1698573 (+)
AMCG00000723 crygs,LOC107756035,LOC107663530,LOC105911960,LOC103033891 other upstream 3743951 1599696 ~ 1606031 (+)
G125561 NA other upstream 4946391 339640 ~ 403591 (+)
AMCG00000848 NA other downstream 111059 5461301 ~ 5465981 (+)
G127134 NA other downstream 3266957 8617199 ~ 8620195 (+)
AMCG00000949 NA other downstream 4750041 10100283 ~ 10154187 (+)
AMCG00001002 myo3b other downstream 6649422 11999664 ~ 12011425 (+)
AMCG00001022 NA other downstream 6938708 12288950 ~ 12385042 (+)

Expression


Co-expression Network