G130466



Basic Information


Item Value
gene id G130466
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 23708720 ~ 23708968 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU163517
caccgatcagccataacattatgaccactgacaggtgaagtgaataacactgataatctcgttatcatggcacctgtcagtgggtgggatatattaggcagcaagtgaacattttgtcctcaaagttgatgtgttagaagcaggaaaaatgggcaagcgcaaggatctgagcgactttgacaagggccaaattgtgatagctagacgactgggtcagagcatctccaaaactgcagctcttgtggggtg

Function


GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA


RNA id representative length rna type GC content exon number start site end site
TU163517 True 249 lncRNA 0.46 1 23708720 23708968

Neighbor


gene id symbol gene type direction distance location
AMCG00001293 eef1b2,eef1d coding downstream 87798 23616471 ~ 23620922 (-)
AMCG00001290 NA coding downstream 309739 23342817 ~ 23398981 (-)
AMCG00001289 NA coding downstream 440769 23247525 ~ 23267951 (-)
AMCG00001287 NA coding downstream 519773 23176343 ~ 23188947 (-)
AMCG00001288 NA coding downstream 545995 23122004 ~ 23162725 (-)
AMCG00001295 NA coding upstream 157653 23866621 ~ 23884688 (-)
AMCG00001296 NA coding upstream 405332 24114300 ~ 24142020 (-)
AMCG00001301 NA coding upstream 646121 24355089 ~ 24365595 (-)
AMCG00001304 NA coding upstream 665707 24374675 ~ 24375851 (-)
AMCG00001308 NA coding upstream 666936 24375904 ~ 24382811 (-)
G130464 NA non-coding downstream 20563 23687827 ~ 23688157 (-)
G130456 NA non-coding downstream 23208 23684874 ~ 23685512 (-)
G130367 NA non-coding downstream 424993 23283476 ~ 23283727 (-)
G130364 NA non-coding downstream 428301 23280208 ~ 23280419 (-)
G130351 NA non-coding downstream 533378 23169816 ~ 23175342 (-)
G130469 ino80d,LOC106582458 non-coding upstream 12855 23721823 ~ 23722067 (-)
G130472 NA non-coding upstream 19655 23728623 ~ 23728858 (-)
G130476 NA non-coding upstream 25718 23734686 ~ 23734910 (-)
G130477 NA non-coding upstream 27266 23736234 ~ 23736592 (-)
G130478 NA non-coding upstream 27712 23736680 ~ 23736978 (-)
AMCG00001291 NA other downstream 153006 23509831 ~ 23555714 (-)
G130244 NA other downstream 1094434 22607142 ~ 22614286 (-)
AMCG00001274 NA other downstream 1243844 22451586 ~ 22464876 (-)
AMCG00001270 NA other downstream 1406272 22259443 ~ 22302448 (-)
AMCG00001268 NA other downstream 1488304 22202046 ~ 22220416 (-)
G130470 NA other upstream 14424 23723392 ~ 23725279 (-)
AMCG00001306 NA other upstream 685558 24394526 ~ 24400546 (-)
AMCG00001303 NA other upstream 695819 24404787 ~ 24419606 (-)
G130622 si:ch211-114n24.6,tuba4a,LOC107387629,LOC107659949,LOC108255233,LOC107659977,LOC107678212 other upstream 726121 24435089 ~ 24439649 (-)
AMCG00001316 cfap65 other upstream 888601 24597569 ~ 24685570 (-)

Expression



Co-expression Network