AMCG00001705 (smap1,LOC108236281,LOC106518784)


Basic Information

Item Value
gene id AMCG00001705
gene name smap1,LOC108236281,LOC106518784
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 12900485 ~ 12902023 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001705
GTCCAAGATGGGCTTCCTGGAATCTGGGCGTTTTTATCTGTATCCGGTGTGCTGGAATACATCGGAATCTAGGCGTCCACATATCCCGGGTCAAGTCGGTCAATCTGGACCAGTGGACGCCAGAACAGATCCAGAGTGTGCAGGATATGGGCAACACCAGGGCCAGAAAACTGTACGAAGCCAATCTTCCAGACAACTTCAGAAGACCTCAAACAGA

Function

symbol description
smap1 Predicted to enable GTPase activator activity. Predicted to be involved in regulation of clathrin-dependent endocytosis. Is expressed in central nervous system and lens. Orthologous to human SMAP1 (small ArfGAP 1).

NR:

description
PREDICTED: stromal membrane-associated protein 1 isoform X1

GO:

id name namespace
GO:0008270 zinc ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001705 True 217 mRNA 0.51 2 12900485 12902023

Neighbor

gene id symbol gene type direction distance location
AMCG00001703 NA coding downstream 29724 12854099 ~ 12870761 (-)
AMCG00001700 NA coding downstream 68151 12825577 ~ 12832334 (-)
AMCG00001701 rims1,LOC102293251 coding downstream 139941 12677472 ~ 12760544 (-)
AMCG00001697 NA coding downstream 236569 12663557 ~ 12663916 (-)
AMCG00001696 NA coding downstream 323915 12544008 ~ 12576570 (-)
AMCG00001707 adgrb3 coding upstream 288102 13190125 ~ 13191677 (-)
AMCG00001706 NA coding upstream 289741 13191764 ~ 13206374 (-)
AMCG00001712 adgrb3,LOC102785729 coding upstream 322393 13224416 ~ 13227590 (-)
AMCG00001711 NA coding upstream 336483 13238506 ~ 13272755 (-)
AMCG00001713 adgrb3 coding upstream 421875 13323898 ~ 13325020 (-)
G159818 NA non-coding downstream 106924 12787082 ~ 12793561 (-)
G159748 NA non-coding downstream 385407 12513392 ~ 12515078 (-)
G159747 NA non-coding downstream 387581 12512352 ~ 12512904 (-)
G159746 NA non-coding downstream 388206 12511622 ~ 12512279 (-)
G159745 slc17a5 non-coding downstream 390192 12509800 ~ 12510293 (-)
G159904 NA non-coding upstream 848857 13750880 ~ 13751089 (-)
G159995 NA non-coding upstream 1273718 14175741 ~ 14203768 (-)
G160025 NA non-coding upstream 1365364 14267387 ~ 14267741 (-)
G160040 NA non-coding upstream 1409118 14311141 ~ 14316143 (-)
G160080 NA non-coding upstream 1518914 14420937 ~ 14517285 (-)
G159303 NA other downstream 2229244 10670437 ~ 10671241 (-)
AMCG00001628 NA other downstream 2678767 10212874 ~ 10221718 (-)
AMCG00001625 NA other downstream 2935077 9952372 ~ 9965408 (-)
AMCG00001615 NA other downstream 3797451 9074089 ~ 9103034 (-)
G158971 map1lc3c,LOC107701141 other downstream 4360227 8514367 ~ 8540258 (-)
AMCG00001702 NA other upstream 29208 12931231 ~ 12937243 (-)
AMCG00001704 fam135a,LOC107601029,LOC107747270,LOC107665594 other upstream 40338 12942361 ~ 12977026 (-)
AMCG00001710 NA other upstream 93614 12995637 ~ 13105424 (-)
G159976 NA other upstream 1245605 14147628 ~ 14151555 (-)
AMCG00001733 NA other upstream 1561707 14463730 ~ 14473159 (-)

Expression


Co-expression Network