AMCG00001879


Basic Information

Item Value
gene id AMCG00001879
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 18661002 ~ 18663390 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001879
ATGAACGTGGCTTTGCTGACGGAGCCGGCAGGTTATTCTGGGCAGTTTAATATTACAAAGAGCTCGGCTCCCCGGGAAGGGTGTGTGTCTGACCGTGCCCCCCTGTGCCACGCTGTGCCCGGCAGGTTCCTGCAGCTGATCGGCGGCCGCCTGGAGGAGATCGGGCAGCCGGAGATGAGGCGCCGCGTCCAGGAGCACGTGCAGCGCGGCGGACTGGACGGCCTGGCCCAGACGCTGGACACCACTCCCGGCACCCTGCAGGTCATCATCGACGGCCTGACGCAGCCCCAGGGCTTCGACATCCGTCAGGACTTCAAGGAGCCGGACTTCAAGCGGGGCATCGTGTCCATGAGCGACCTGCGGGTGGGCGCCGTGCTCACGGGCAAGGTGGAGAACACGGCGCTGTTTGGGGCCTTCGTGGACATCGGCGTGGGCCGCTCGGGCCTCATCCACAAGAAGTACATCACCGAGGCCAAGCTGCCACCGGACCAGCGGCGCCGCAGCCTGGCGCTGGGCCCGGGGGAGCGCGTGGAGGTGCGGGTGCTGAGCGTGGACGCCCAGCGCGGCCGCATCGGGCTGGACCTCGTCCGGGTGCTCCGATGA

Function

GO:

id name namespace
GO:0051983 regulation of chromosome segregation biological_process
GO:0051985 negative regulation of chromosome segregation biological_process
GO:0051726 regulation of cell cycle biological_process
GO:0000075 cell cycle checkpoint biological_process
GO:1905818 regulation of chromosome separation biological_process
GO:1905819 negative regulation of chromosome separation biological_process
GO:0045786 negative regulation of cell cycle biological_process
GO:0010948 negative regulation of cell cycle process biological_process
GO:1902099 regulation of metaphase/anaphase transition of cell cycle biological_process
GO:1902100 negative regulation of metaphase/anaphase transition of cell cycle biological_process
GO:0031577 spindle checkpoint biological_process
GO:0010965 regulation of mitotic sister chromatid separation biological_process
GO:0051784 negative regulation of nuclear division biological_process
GO:0044784 metaphase/anaphase transition of cell cycle biological_process
GO:0045839 negative regulation of mitotic nuclear division biological_process
GO:0045841 negative regulation of mitotic metaphase/anaphase transition biological_process
GO:2000816 negative regulation of mitotic sister chromatid separation biological_process
GO:0007346 regulation of mitotic cell cycle biological_process
GO:0071173 spindle assembly checkpoint biological_process
GO:0071174 mitotic spindle checkpoint biological_process
GO:0051304 chromosome separation biological_process
GO:0051306 mitotic sister chromatid separation biological_process
GO:0007091 metaphase/anaphase transition of mitotic cell cycle biological_process
GO:0007093 mitotic cell cycle checkpoint biological_process
GO:0007094 mitotic spindle assembly checkpoint biological_process
GO:0033045 regulation of sister chromatid segregation biological_process
GO:0033046 negative regulation of sister chromatid segregation biological_process
GO:0033047 regulation of mitotic sister chromatid segregation biological_process
GO:0033048 negative regulation of mitotic sister chromatid segregation biological_process
GO:0045930 negative regulation of mitotic cell cycle biological_process
GO:1903047 mitotic cell cycle process biological_process
GO:0030071 regulation of mitotic metaphase/anaphase transition biological_process
GO:1901988 negative regulation of cell cycle phase transition biological_process
GO:1901991 negative regulation of mitotic cell cycle phase transition biological_process
GO:0000278 mitotic cell cycle biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001879 True 603 mRNA 0.68 3 18661002 18663390

Neighbor

gene id symbol gene type direction distance location
AMCG00001878 six2a,six2,LOC107666385,LOC107602488,LOC107711421,LOC107602487,LOC107585295,LOC107733704 coding downstream 84438 18572048 ~ 18576564 (-)
AMCG00001876 NA coding downstream 297745 18358033 ~ 18363257 (-)
AMCG00001884 NA coding downstream 382110 18232030 ~ 18278892 (-)
AMCG00001885 NA coding downstream 437250 18216946 ~ 18223752 (-)
AMCG00001870 NA coding downstream 473019 18135097 ~ 18187983 (-)
AMCG00001887 NA coding upstream 42733 18706123 ~ 18719975 (-)
AMCG00001893 pigf,LOC107550047,LOC107698824,LOC107749355 coding upstream 225061 18888451 ~ 18898999 (-)
AMCG00001892 LOC108429343,LOC106589406 coding upstream 241805 18905195 ~ 18910940 (-)
AMCG00001891 mcfd2 coding upstream 311641 18975031 ~ 18979293 (-)
AMCG00001902 NA coding upstream 377063 19040453 ~ 19042847 (-)
G161030 NA non-coding downstream 314980 18262244 ~ 18346022 (-)
G161039 NA non-coding downstream 356904 18301084 ~ 18304098 (-)
G160944 NA non-coding downstream 621628 18038704 ~ 18039374 (-)
G160928 NA non-coding downstream 745311 17915418 ~ 17915691 (-)
G160903 NA non-coding downstream 794781 17866016 ~ 17866221 (-)
G161161 NA non-coding upstream 222904 18886294 ~ 18887568 (-)
G161165 cript,LOC107582781,LOC107728714 non-coding upstream 235757 18899147 ~ 18901718 (-)
G161206 NA non-coding upstream 420722 19084112 ~ 19084976 (-)
G161302 NA non-coding upstream 791734 19455124 ~ 19457742 (-)
G161346 LOC107739892 non-coding upstream 1428723 20092113 ~ 20093345 (-)
G160925 mta3,LOC105904126,LOC106516625,LOC107749351 other downstream 750149 17908754 ~ 17910853 (-)
AMCG00001863 LOC105006094,LOC104951035,LOC101160874,LOC106578938 other downstream 795623 17860139 ~ 17865379 (-)
AMCG00001865 NA other downstream 850905 17808018 ~ 17810097 (-)
G160817 NA other downstream 1129012 17530866 ~ 17531990 (-)
AMCG00001843 NA other downstream 1568453 17091353 ~ 17092549 (-)
G161153 NA other upstream 172392 18835782 ~ 18850884 (-)
AMCG00001945 NA other upstream 1677035 20340425 ~ 20347505 (-)

Expression


Co-expression Network