AMCG00001912 (kcnk12,LOC106515821)


Basic Information

Item Value
gene id AMCG00001912
gene name kcnk12,LOC106515821
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 19127262 ~ 19131079 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001912
ATGATGCCCGGCCGGCGGGTGCGAGGATGCCGCTCCCCGCTGCACATCAACGAGGACACCGGGCGCTTCCTGCTGCTGGCGCTGCTCATCGCGCTGTACCTGCTGTGCGGCGCCGCCGTCTTCTCCGCCGTCGAGAGACCCTCCGAGCTGGCAGCGCAGCGCCGCTGGAACCGGACCCTGTCCAACTTCAGCGACACCTTCAACATCAGCCTGCGGGAGCTGAGCGCTTTCCTGCGGGACTATGAGGCGGCGATCGCGGCCGGGATCAGGGCGGATCCCCAGAGACCACGATGGGACTTCACGGGGGCTTTCTACTTTGTCGGGACAGTGGTGTCCACTATTGGGACGATCAGACATTCTTTGGAGTTGCGGGGCGGGCAGCTCTTTGTCTACAGATGTCCACCCACCGTAATCACAACAGATGTGGCCCTGAAAGGACGCAGTTTCCTCGCCTCACTGCGCCCCGAGATCGCCAGCCTGCTCTGCTATTCCTAA

Function

symbol description
kcnk12 Orthologous to human KCNK12 (potassium two pore domain channel subfamily K member 12).

NR:

description
PREDICTED: potassium channel subfamily K member 12-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001912 True 495 mRNA 0.63 2 19127262 19131079

Neighbor

gene id symbol gene type direction distance location
AMCG00001911 kcnk12,LOC107589351,LOC107679129 coding downstream 11618 19114763 ~ 19115644 (-)
AMCG00001901 NA coding downstream 49105 19064520 ~ 19078157 (-)
AMCG00001905 NA coding downstream 72290 19054745 ~ 19054972 (-)
AMCG00001906 NA coding downstream 72637 19054329 ~ 19054625 (-)
AMCG00001904 NA coding downstream 73017 19053730 ~ 19054245 (-)
AMCG00001910 fbxo11,LOC107550041,LOC107749363,LOC108430631,LOC108413220,LOC107728720 coding upstream 46186 19177265 ~ 19186120 (-)
AMCG00001914 NA coding upstream 156199 19287278 ~ 19299869 (-)
AMCG00001913 NA coding upstream 179959 19311038 ~ 19323661 (-)
AMCG00001916 LOC104952680,LOC108443646 coding upstream 328201 19459280 ~ 19460843 (-)
AMCG00001917 NA coding upstream 376918 19507997 ~ 19511624 (-)
G161206 NA non-coding downstream 42286 19084112 ~ 19084976 (-)
G161165 cript,LOC107582781,LOC107728714 non-coding downstream 225544 18899147 ~ 18901718 (-)
G161161 NA non-coding downstream 239694 18886294 ~ 18887568 (-)
G161030 NA non-coding downstream 781240 18262244 ~ 18346022 (-)
G161302 NA non-coding upstream 324045 19455124 ~ 19457742 (-)
G161346 LOC107739892 non-coding upstream 961034 20092113 ~ 20093345 (-)
G161391 NA non-coding upstream 1094578 20225657 ~ 20225919 (-)
G161475 NA non-coding upstream 1307389 20438468 ~ 20438673 (-)
G161471 if3ei,eif3l,LOC106576896 non-coding upstream 1344849 20475928 ~ 20478231 (-)
G161153 NA other downstream 276378 18835782 ~ 18850884 (-)
G160925 mta3,LOC105904126,LOC106516625,LOC107749351 other downstream 1216409 17908754 ~ 17910853 (-)
AMCG00001863 LOC105006094,LOC104951035,LOC101160874,LOC106578938 other downstream 1261883 17860139 ~ 17865379 (-)
AMCG00001865 NA other downstream 1317165 17808018 ~ 17810097 (-)
G160817 NA other downstream 1595272 17530866 ~ 17531990 (-)
AMCG00001945 NA other upstream 1209346 20340425 ~ 20347505 (-)

Expression


Co-expression Network