G160025


Basic Information

Item Value
gene id G160025
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 14267387 ~ 14267741 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU201466
ccatccaagcaatgtggggaagcaataaaaaaggcaaacgcaatgttagggtatattgtcaaaagtgtagaattgagaacaagggcagtgatgttcagactgtacaatgcactagttagagctcatctggatactgtggacagttctgggctccacacttcaagaaagatatcgctgctctagaggcagttcagaggagagcaaccagacttattccaggtctgaagggaaagtcctactgagagactgaggaactgaaccttttcaccctggaacagaggagactacgtggggacttgatccaagtcttcaaaatcatgaaaggcatcgaccacatcaaaccagaggagctttg

Function

GO: NA

KEGG:

id description
ko04064 NF-kappa B signaling pathway
ko04640 Hematopoietic cell lineage
ko04660 T cell receptor signaling pathway
ko04658 Th1 and Th2 cell differentiation
ko04659 Th17 cell differentiation

RNA

RNA id representative length rna type GC content exon number start site end site
TU201466 True 355 lncRNA 0.46 1 14267387 14267741

Neighbor

gene id symbol gene type direction distance location
AMCG00001729 NA coding downstream 197512 14060233 ~ 14069875 (-)
AMCG00001726 NA coding downstream 207661 14057676 ~ 14059726 (-)
AMCG00001728 NA coding downstream 226207 14038870 ~ 14041180 (-)
AMCG00001727 prim2,LOC107743543,LOC107725490,LOC107676604,LOC102784181,LOC108443732,LOC108263846 coding downstream 282060 13978613 ~ 13985327 (-)
AMCG00001715 NA coding downstream 358417 13823609 ~ 13908970 (-)
AMCG00001744 NA coding upstream 73017 14340758 ~ 14343171 (-)
AMCG00001743 hcrtr2,LOC107699124,LOC107597943 coding upstream 80352 14348093 ~ 14359579 (-)
AMCG00001731 NA coding upstream 97706 14365447 ~ 14380677 (-)
AMCG00001732 NA coding upstream 130794 14398535 ~ 14421490 (-)
AMCG00001735 NA coding upstream 157534 14425275 ~ 14431342 (-)
G159995 NA non-coding downstream 63619 14175741 ~ 14203768 (-)
G159904 NA non-coding downstream 516298 13750880 ~ 13751089 (-)
G159818 NA non-coding downstream 1473826 12787082 ~ 12793561 (-)
G159748 NA non-coding downstream 1752309 12513392 ~ 12515078 (-)
G159747 NA non-coding downstream 1754483 12512352 ~ 12512904 (-)
G160040 NA non-coding upstream 43400 14311141 ~ 14316143 (-)
G160080 NA non-coding upstream 153196 14420937 ~ 14517285 (-)
G160085 NA non-coding upstream 206501 14474242 ~ 14480359 (-)
G160094 NA non-coding upstream 224157 14491898 ~ 14493649 (-)
G160132 NA non-coding upstream 291411 14559152 ~ 14563505 (-)
G159976 NA other downstream 115832 14147628 ~ 14151555 (-)
AMCG00001710 NA other downstream 1161963 12995637 ~ 13105424 (-)
AMCG00001704 fam135a,LOC107601029,LOC107747270,LOC107665594 other downstream 1290361 12942361 ~ 12977026 (-)
AMCG00001702 NA other downstream 1330144 12931231 ~ 12937243 (-)
G159303 NA other downstream 3596146 10670437 ~ 10671241 (-)
AMCG00001733 NA other upstream 195989 14463730 ~ 14473159 (-)
AMCG00001756 NA other upstream 282948 14550689 ~ 14570927 (-)
AMCG00001771 banf1,LOC105900308,LOC107086546,LOC106536379,LOC106576720 other upstream 1231812 15499553 ~ 15501793 (-)
G160255 NA other upstream 1236570 15504311 ~ 15520639 (-)
AMCG00001784 NA other upstream 1423828 15691569 ~ 15702500 (-)

Expression


Co-expression Network