G160548 (ryr2,LOC107395022,LOC102799451)


Basic Information

Item Value
gene id G160548
gene name ryr2,LOC107395022,LOC102799451
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030143.1
NCBI id CM030143.1
chromosome length 20516281
location 16315327 ~ 16315563 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU202128
CACAGATGAAGACCATCAAAGCCATAGGAGTAGAGGTCATCGCCAACACCGTTGCCCCCCCAGCCTTCACCACCTCCTGGGTAGGGGGAGTAACCATCTGTGGACGCCCATCCAACTCTTAAGTGCGTTGCCTCTGCTGTGACAAAGGACTCCACGTGGTCCACGATCAGCTCATAGTACCACTTCCTGTACTGGGCGGAACCCTCACTGATCCCCAGGAAGATATTTGGCCGCATG

Function

symbol description
ryr2 Enables several functions, including calcium-release channel activity; calmodulin binding activity; and protein kinase A binding activity. Involved in several processes, including calcium-mediated signaling using intracellular calcium source; regulation of cardiac muscle cell action potential; and regulation of heart contraction. Located in Z disc; membrane; and sarcoplasmic reticulum. Part of calcium channel complex. Implicated in arrhythmogenic right ventricular cardiomyopathy; arrhythmogenic right ventricular dysplasia 2; and catecholaminergic polymorphic ventricular tachycardia 1.

NR:

description
PREDICTED: ryanodine receptor 2, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU202128 True 237 lncRNA 0.56 1 16315327 16315563

Neighbor

gene id symbol gene type direction distance location
AMCG00001804 tubb4b,tbb2c,LOC105023713,LOC105029894,LOC106575097,LOC107693853 coding downstream 35935 16273328 ~ 16279392 (-)
AMCG00001802 LOC107675669 coding downstream 117831 16177185 ~ 16197496 (-)
AMCG00001801 NA coding downstream 138773 16171241 ~ 16176554 (-)
AMCG00001803 LOC107680460,LOC102314080 coding downstream 144872 16167863 ~ 16170455 (-)
AMCG00001810 NA coding downstream 166752 16146837 ~ 16148575 (-)
AMCG00001816 grem2,grem2b,LOC107570400,LOC107746751,LOC107659701 coding upstream 319901 16635464 ~ 16644981 (-)
AMCG00001817 rgs7 coding upstream 330364 16645927 ~ 16678629 (-)
AMCG00001827 fh coding upstream 408912 16724475 ~ 16732575 (-)
AMCG00001826 NA coding upstream 456613 16772176 ~ 16778573 (-)
AMCG00001829 NA coding upstream 482002 16797565 ~ 16797975 (-)
G160538 NA non-coding downstream 79524 16234415 ~ 16235803 (-)
G160387 fbxo28,LOC106576958 non-coding downstream 518969 15791996 ~ 15796358 (-)
G160319 NA non-coding downstream 704611 15603843 ~ 15610716 (-)
G160311 NA non-coding downstream 719972 15594607 ~ 15595355 (-)
G160132 NA non-coding downstream 1751822 14559152 ~ 14563505 (-)
G160631 NA non-coding upstream 501376 16816939 ~ 16817195 (-)
G160640 NA non-coding upstream 539090 16854653 ~ 16854957 (-)
G160682 NA non-coding upstream 659885 16975448 ~ 16975879 (-)
G160783 NA non-coding upstream 1092648 17408211 ~ 17408617 (-)
G160842 NA non-coding upstream 1286518 17602081 ~ 17604562 (-)
AMCG00001791 fam98a other downstream 481521 15828758 ~ 15833806 (-)
AMCG00001784 NA other downstream 612827 15691569 ~ 15702500 (-)
G160255 NA other downstream 794688 15504311 ~ 15520639 (-)
AMCG00001771 banf1,LOC105900308,LOC107086546,LOC106536379,LOC106576720 other downstream 813534 15499553 ~ 15501793 (-)
AMCG00001756 NA other downstream 1744400 14550689 ~ 14570927 (-)
AMCG00001843 NA other upstream 775790 17091353 ~ 17092549 (-)
G160817 NA other upstream 1215303 17530866 ~ 17531990 (-)
AMCG00001865 NA other upstream 1492455 17808018 ~ 17810097 (-)
AMCG00001863 LOC105006094,LOC104951035,LOC101160874,LOC106578938 other upstream 1544576 17860139 ~ 17865379 (-)
G160925 mta3,LOC105904126,LOC106516625,LOC107749351 other upstream 1593191 17908754 ~ 17910853 (-)

Expression


Co-expression Network