AMCG00002046 (trim62,LOC102789653)


Basic Information

Item Value
gene id AMCG00002046
gene name trim62,LOC102789653
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 1750215 ~ 1750664 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002046
ATGGCTTGTAGTCTCAAGGACGAGCTGCTGTGCTCCATCTGCCTGAGCATCTACCAGGACCCGGTGAGCTTCGGCTGCGAGCACTACTTCTGCCGCAAGTGCATCACCGAGCACTGGAGCCGCCAGGAGCCCCACGGGGCCCGGGACTGCCCGGAGTGCCGGCGGACCTTTGCCGACCCGCTGCTCTCGCCCAGCCTCAAGCTGTCCAACATCGTGGAGCGCTACGCCGCCTTCCCGCTGGACGCCATCCTGAACGCCCAGCGCAGCTCCTACCCCTGCAAGGACCACGAGAAGGTCAAGCTCTTCTGCCTGAGCGACCAGAGCCTGGTGTGCTTCTTCTGCGACGAGCCCGCCCTGCACGAACAGCACCAGGTCACCAGCATCGACGAGGCCTTCGAGGAGATCCAGGTCAGTCACTCAGACCTCTGTCTTCTCCCACCTGGAGAGTGA

Function

symbol description
trim62 Enables identical protein binding activity; transcription coactivator activity; and ubiquitin-protein transferase activity. Involved in several processes, including negative regulation of viral transcription; positive regulation of NF-kappaB transcription factor activity; and positive regulation of antifungal innate immune response. Is active in cytoplasm.

NR:

description
E3 ubiquitin-protein ligase TRIM62

GO:

id name namespace
GO:0005622 intracellular anatomical structure cellular_component
GO:0008270 zinc ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002046 True 450 mRNA 0.64 1 1750215 1750664

Neighbor

gene id symbol gene type direction distance location
AMCG00002045 wnt4,wnt4a,LOC107654388,LOC107565731 coding upstream 40628 1703230 ~ 1709587 (+)
AMCG00002039 cdc42,LOC101067723 coding upstream 277839 1464244 ~ 1472376 (+)
AMCG00002038 cunh1orf50,LOC107654415,LOC107582467,LOC107756638,LOC107751182,LOC105895900 coding upstream 311517 1433108 ~ 1438698 (+)
AMCG00002041 NA coding upstream 339377 1392260 ~ 1410838 (+)
AMCG00002040 NA coding upstream 361639 1386668 ~ 1388576 (+)
AMCG00002047 trim62,LOC107756651 coding downstream 52122 1802786 ~ 1809281 (+)
AMCG00002048 znf362,LOC105894282,LOC106582819 coding downstream 101331 1851995 ~ 1873164 (+)
AMCG00002050 NA coding downstream 136565 1887229 ~ 1904008 (+)
AMCG00002053 NA coding downstream 235096 1985760 ~ 1986389 (+)
AMCG00002052 NA coding downstream 277949 2028613 ~ 2032618 (+)
G120254 NA non-coding upstream 1082158 667739 ~ 668057 (+)
G120201 NA non-coding upstream 1627047 122542 ~ 123168 (+)
G120193 ube2j2,LOC107599097 non-coding upstream 1646942 100119 ~ 103273 (+)
G120494 NA non-coding downstream 123548 1874212 ~ 1876528 (+)
G120516 NA non-coding downstream 147270 1897934 ~ 1955361 (+)
G120536 NA non-coding downstream 245763 1996427 ~ 2005914 (+)
G120563 NA non-coding downstream 422806 2173470 ~ 2174499 (+)
G120564 NA non-coding downstream 423923 2174587 ~ 2176442 (+)
AMCG00002019 NA other upstream 757451 682670 ~ 992764 (+)
G120518 NA other downstream 173358 1924022 ~ 1940816 (+)
AMCG00002076 NA other downstream 1101490 2852154 ~ 2854127 (+)
G120742 NA other downstream 1206244 2956908 ~ 2959475 (+)
AMCG00002098 NA other downstream 1783150 3533814 ~ 3542177 (+)
AMCG00002152 NA other downstream 3468166 5218830 ~ 5226656 (+)

Expression


Co-expression Network