AMCG00002146 (ephb2)


Basic Information

Item Value
gene id AMCG00002146
gene name ephb2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 4997545 ~ 5000508 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002146
TGTCCGTCGGGCTTCTTCAAACCAGCCCAGGGGGACGATGCCTGCCTGCAGTGTCCCATCAACAGCCGCACCACCTCGGAAGGAGCCACCAACTGCGTCTGCCGCAACGGCTACTACCGCACGGACTCGGACCCCTTCGAAATGCCGTGCACAACGATCCCCTCTGCGCCGCAGAACGTCATCTCCAGTGTGAACGAGACCTCCCTGATGCTCGAGTGGACCCCTCCGCGTGAGGCGGGAGGCCGCGAGGACGTGGTCTACAACATCATCTGCAAGAGCTGTGGGGCGGGCCGGGGGGCTTGCACACGGTGCGGGGACAACGTGCAGTTCGTCCCGCGGCAGCTGGGCCTGACCGAGCCGCGCGTCTACATCAGCGACCTGCTGGCCCACACGCAGTACACCTTCGAGATTCAGGCGGTGAACGGCGTGTCCGACCAGAGCCCCTACTCTCCGCAGTTCTCCGCCGTCAACATCACCACCAACCAGGCCGGTGAGTCTTGTGTGCCGAGGTGA

Function

symbol description
ephb2 Predicted to enable amyloid-beta binding activity and transmembrane-ephrin receptor activity. Involved in several processes, including positive regulation of B cell proliferation; positive regulation of gene expression; and regulation of blood coagulation. Located in nucleoplasm and plasma membrane. Implicated in blood platelet disease. Biomarker of cognitive disorder and human immunodeficiency virus infectious disease.

NR:

description
PREDICTED: ephrin type-B receptor 2 isoform X6

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002146 True 513 mRNA 0.65 2 4997545 5000508

Neighbor

gene id symbol gene type direction distance location
AMCG00002145 LOC102295218,LOC102203423,LOC101487531,LOC102781222 coding upstream 29825 4963054 ~ 4967720 (+)
AMCG00002143 NA coding upstream 205877 4788512 ~ 4791668 (+)
AMCG00002140 LOC107727752 coding upstream 275614 4690966 ~ 4721931 (+)
AMCG00002133 NA coding upstream 410687 4584435 ~ 4586858 (+)
AMCG00002134 NA coding upstream 428277 4562912 ~ 4569268 (+)
AMCG00002148 ephb2,LOC104917933,LOC108439490,LOC102781222 coding downstream 14242 5014750 ~ 5022684 (+)
AMCG00002147 LOC106565894,LOC106582986 coding downstream 33802 5034310 ~ 5036785 (+)
AMCG00002149 lrrc38,LOC107685631,LOC106582984 coding downstream 84387 5084895 ~ 5089872 (+)
AMCG00002150 vps13d coding downstream 127551 5128059 ~ 5196093 (+)
AMCG00002151 NA coding downstream 237803 5238311 ~ 5240700 (+)
G121114 NA non-coding upstream 245211 4749128 ~ 4752334 (+)
G121045 NA non-coding upstream 415265 4581973 ~ 4582280 (+)
G121044 NA non-coding upstream 415666 4580854 ~ 4581879 (+)
G120974 NA non-coding upstream 910073 4087159 ~ 4087472 (+)
G120961 NA non-coding upstream 1056829 3940456 ~ 3940716 (+)
G121176 NA non-coding downstream 200894 5201402 ~ 5202462 (+)
G121178 dhrs3 non-coding downstream 202341 5202849 ~ 5204614 (+)
G121187 NA non-coding downstream 227166 5227674 ~ 5228099 (+)
G121198 NA non-coding downstream 243201 5243709 ~ 5275923 (+)
G121228 NA non-coding downstream 473628 5474136 ~ 5570247 (+)
AMCG00002098 NA other upstream 1455368 3533814 ~ 3542177 (+)
G120742 NA other upstream 2038070 2956908 ~ 2959475 (+)
AMCG00002076 NA other upstream 2143418 2852154 ~ 2854127 (+)
G120518 NA other upstream 3056729 1924022 ~ 1940816 (+)
AMCG00002019 NA other upstream 4004781 682670 ~ 992764 (+)
AMCG00002152 NA other downstream 218322 5218830 ~ 5226656 (+)
AMCG00002190 acot7 other downstream 1586146 6586654 ~ 6602608 (+)
AMCG00002215 NA other downstream 2393292 7393800 ~ 7411230 (+)
AMCG00002245 NA other downstream 3738263 8738771 ~ 8792478 (+)
AMCG00002272 NA other downstream 4843697 9844205 ~ 9851312 (+)

Expression


Co-expression Network