AMCG00002177


Basic Information

Item Value
gene id AMCG00002177
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 6247266 ~ 6247869 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002177
ATGGCGCCTGTAAACATTTGCAACATGGCTCTCAGCTCAAAAGACAAAATCAAATTGAGAAAACCGGTGGTGGAGAAGATGCGCAGGGACCGCATCAACCACAGCATTGAGCAGCTGAAGAAGCTGCTGGAAACCGAATTTAAAGCGAGCCAGCCCAGCTCCAAGCTGGAGAAGGCTGACATCCTGGAGATGGCAGTCTGCTACCTGAGGGAGAACTTCCATCCCTCTGCGCTCTTCAAGACCGCCACTCCGAGGCAAGGCTACGCGGAGGGCTTTTCCAAGTGCCTGGAGGAGACCCTGCGCTTCTTGTCGGTGCACGACCCTCTGAAGGAGTCCCAGGTCAAGGTGCTGAACCACTTCCACAAGGCCGAGCAGGCCAGCAGCAGGGAGCCCCCCAGCTCCGCGGTTCCCGCTGCCCACCCTGCCCACATCCTCGCTCCCAAGCGCGCCGTGCCCAGCAGTGCCAAGTCTCTGTGGAGACCCTGGTGA

Function

GO: NA

KEGG:

id description
K06055 HES5; hairy and enhancer of split 5

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002177 True 489 mRNA 0.59 2 6247266 6247869

Neighbor

gene id symbol gene type direction distance location
AMCG00002172 mrto4,LOC106582960 coding downstream 138782 6106190 ~ 6108484 (-)
AMCG00002173 megf6 coding downstream 161314 6033844 ~ 6085952 (-)
AMCG00002164 LOC107385009 coding downstream 344193 5888490 ~ 5903073 (-)
AMCG00002166 NA coding downstream 363555 5874782 ~ 5883711 (-)
AMCG00002157 LOC106565901,LOC108438575,LOC104956748,LOC102783840,LOC107751159 coding downstream 419741 5804842 ~ 5827525 (-)
AMCG00002178 NA coding upstream 10178 6258047 ~ 6262305 (-)
AMCG00002185 rnf207b,LOC108434591,LOC107593377,LOC107712689,LOC106572244 coding upstream 109788 6357657 ~ 6381431 (-)
AMCG00002187 NA coding upstream 180496 6428365 ~ 6447619 (-)
AMCG00002191 espn coding upstream 203405 6451274 ~ 6500272 (-)
AMCG00002193 NA coding upstream 418245 6666114 ~ 6667451 (-)
G121384 NA non-coding downstream 33606 6210585 ~ 6213660 (-)
G121288 NA non-coding downstream 309433 5933658 ~ 5937833 (-)
G121274 NA non-coding downstream 373130 5871668 ~ 5874136 (-)
G121271 NA non-coding downstream 385624 5858001 ~ 5861642 (-)
G121188 NA non-coding downstream 1019135 5227674 ~ 5228131 (-)
G121403 NA non-coding upstream 29599 6277468 ~ 6277902 (-)
G121443 rpl22,LOC107737574,LOC107703077,LOC103047485,LOC107593380,LOC108414460 non-coding upstream 134564 6382433 ~ 6385919 (-)
G121444 NA non-coding upstream 159836 6407705 ~ 6407915 (-)
G121445 chd5,LOC107737210,LOC107691315 non-coding upstream 165144 6413013 ~ 6413274 (-)
G121447 NA non-coding upstream 172172 6420041 ~ 6424298 (-)
AMCG00002167 NA other downstream 231873 5975725 ~ 6015393 (-)
G120993 NA other downstream 2027389 4214715 ~ 4219877 (-)
G120927 slc45a1,LOC107756616,LOC106565711,LOC107702000 other downstream 2460722 3784236 ~ 3786544 (-)
G120907 NA other downstream 2531014 3713867 ~ 3716252 (-)
AMCG00002097 NA other downstream 2780805 3407485 ~ 3466461 (-)
AMCG00002223 NA other upstream 1578772 7826641 ~ 7839411 (-)
AMCG00002265 NA other upstream 3360881 9608750 ~ 9620127 (-)
AMCG00002275 ube4b,LOC107681967,LOC107570768 other upstream 3509556 9757425 ~ 9801108 (-)
AMCG00002276 NA other upstream 3582650 9830519 ~ 9833224 (-)
AMCG00002279 NA other upstream 3589049 9836918 ~ 9853075 (-)

Expression


Co-expression Network