AMCG00002201 (prdm16)


Basic Information

Item Value
gene id AMCG00002201
gene name prdm16
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 6923998 ~ 6939545 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002201
ATGAGAGGCACAGTCGACTGTACAAGGTACTCTCTACTCGTCTCCTGCTCCAGTTTACCACACTCCCGCTGTCTGTCGCCGAAGAGCCTGAAGTACCTTCTCCCTTCGGTCTCTCTTCGGCATTCCAGCACTCCCGGTGACAGTGAGGCAGTGGATAACATGTACGAGACGGACCCCGACCTCCCCGCCGGAGAGAGCGCCGAGGAGGAGACTGAAGACAGCATCATGTCCCCCATCCCGGTGGGGCCTCCGTCCCCTCTCCCCAACGCCGAGGACTTCACGCCCAAGGAGGGGTCCCCTTATGAGGCCCCCGTCTACATTCCCGACGACATTCCCATTCCCAGCGACCTGGAGCTGCGGGAGTCCTCTGTCCCGGGAGCGGGGTTAGGGATATGGGCCAAGAAGAGGATCGGGCCCGGGGAGCGATTTGGACCATACACTGGAATGCAGAACGCCACGGTGAAGGAGACCACTTTTGGATGGGAGAAACAACGACAACGAAAGGATGACTTGAGTCTAACTCACAGCTATGACCTTGAGGAAGAGTCTCTTTACCGTGACTATGCCGGTCCAGAGATCCGGTCGAACGTCTGTTGA

Function

symbol description
prdm16 Predicted to enable metal ion binding activity. Acts upstream of or within several processes, including cardiac muscle cell proliferation; embryonic cranial skeleton morphogenesis; and hematopoietic stem cell differentiation. Is expressed in several structures, including hindbrain neural rod; nervous system; pectoral fin bud; pronephric duct; and stomodeum. Orthologous to human PRDM16 (PR/SET domain 16).

NR:

description
PREDICTED: PR domain zinc finger protein 16 isoform X1

GO:

id name namespace
GO:0061337 cardiac conduction biological_process
GO:0060038 cardiac muscle cell proliferation biological_process
GO:0048702 embryonic neurocranium morphogenesis biological_process
GO:0048703 embryonic viscerocranium morphogenesis biological_process
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002201 True 597 mRNA 0.58 4 6923998 6939545

Neighbor

gene id symbol gene type direction distance location
AMCG00002200 NA coding downstream 99299 6797887 ~ 6824699 (-)
AMCG00002199 tprg1l coding downstream 131727 6786127 ~ 6792271 (-)
AMCG00002197 NA coding downstream 188186 6729634 ~ 6735812 (-)
AMCG00002196 NA coding downstream 210801 6712997 ~ 6713197 (-)
AMCG00002198 NA coding downstream 217474 6683032 ~ 6706524 (-)
AMCG00002208 mfn2,LOC107748965 coding upstream 136204 7075749 ~ 7086413 (-)
AMCG00002209 NA coding upstream 151295 7090840 ~ 7109181 (-)
AMCG00002210 clcn6 coding upstream 225552 7165097 ~ 7177984 (-)
AMCG00002212 NA coding upstream 270721 7210266 ~ 7212964 (-)
AMCG00002219 ski coding upstream 625854 7565399 ~ 7582098 (-)
G121447 NA non-coding downstream 499700 6420041 ~ 6424298 (-)
G121445 chd5,LOC107737210,LOC107691315 non-coding downstream 510724 6413013 ~ 6413274 (-)
G121444 NA non-coding downstream 516083 6407705 ~ 6407915 (-)
G121443 rpl22,LOC107737574,LOC107703077,LOC103047485,LOC107593380,LOC108414460 non-coding downstream 538079 6382433 ~ 6385919 (-)
G121403 NA non-coding downstream 646096 6277468 ~ 6277902 (-)
G121689 NA non-coding upstream 621532 7561077 ~ 7562747 (-)
G121716 NA non-coding upstream 718287 7657832 ~ 7658851 (-)
G121718 NA non-coding upstream 723441 7662986 ~ 7663677 (-)
G121754 NA non-coding upstream 890648 7830193 ~ 7845316 (-)
G121789 NA non-coding upstream 1076519 8016064 ~ 8017075 (-)
AMCG00002167 NA other downstream 908605 5975725 ~ 6015393 (-)
G120993 NA other downstream 2704121 4214715 ~ 4219877 (-)
G120927 slc45a1,LOC107756616,LOC106565711,LOC107702000 other downstream 3137454 3784236 ~ 3786544 (-)
G120907 NA other downstream 3207746 3713867 ~ 3716252 (-)
AMCG00002097 NA other downstream 3457537 3407485 ~ 3466461 (-)
AMCG00002223 NA other upstream 887096 7826641 ~ 7839411 (-)
AMCG00002265 NA other upstream 2669205 9608750 ~ 9620127 (-)
AMCG00002275 ube4b,LOC107681967,LOC107570768 other upstream 2817880 9757425 ~ 9801108 (-)
AMCG00002276 NA other upstream 2890974 9830519 ~ 9833224 (-)
AMCG00002279 NA other upstream 2897373 9836918 ~ 9853075 (-)

Expression


Co-expression Network