AMCG00002385 (tsnare1,si:ch211-208k15.1,LOC106605505,LOC107679652)


Basic Information

Item Value
gene id AMCG00002385
gene name tsnare1,si:ch211-208k15.1,LOC106605505,LOC107679652
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 12483894 ~ 12504026 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002385
ATGTACCTAGAGGCGGCCGGCCGCTCAGCCCCGTGGCTCGGAGATGCGGAGGTCAGACACTCCACTCAGCAGCAGACCAACAGAGAGATCACCAGCACCAGCCAGCTCATCAAGCAGCTCTGTGACATCATCAGTGGCTCCTCACGGCAGGACCGCCTTAGACTAACCCGGCTAAAGACGGAGCTGTCTGAGTCCGTTCAGCGCTATGGAGACCTGCAAAAGAAAATTGCAGACAGGTCCCGAGCCTTGCTTCCCCCCGCACAGAAGGAGCGAAAACCGAGTCCCCAGACCCCCTTCGCGGAGCTGTGCGATGAGGAGCCGGTGTTCGGCCGAGCAGAGACAGCGGAAGGGGACGGCCAGGCCTTCCTGTCCGAGATCAGCGAGGAGGACGTGGAGGCTCTGCGGCTGAGGGAAGAGGCACTGCTGCAGATAGAGAGGGACATGCTGGACGTCAGCCAGATAATGAAGGATCTGGCCTCTCTGGTGCATGAGCAAGGGGACGCCATCGGTACGATTTGA

Function

symbol description
tsnare1 Predicted to enable SNAP receptor activity and SNARE binding activity. Predicted to be involved in intracellular protein transport; vesicle docking; and vesicle fusion. Predicted to act upstream of or within vesicle-mediated transport. Predicted to be located in membrane. Predicted to be part of SNARE complex. Predicted to be active in endomembrane system. Predicted to be integral component of membrane. Orthologous to human TSNARE1 (t-SNARE domain containing 1).

NR:

description
PREDICTED: t-SNARE domain-containing protein 1

GO: NA

KEGG:

id description
K13814 TSNARE1; t-SNARE domain-containing protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002385 True 519 mRNA 0.61 7 12483894 12504026

Neighbor

gene id symbol gene type direction distance location
AMCG00002383 NA coding downstream 223488 12251292 ~ 12260406 (-)
AMCG00002384 NA coding downstream 234948 12248147 ~ 12248946 (-)
AMCG00002382 smarcc1,LOC106605342,LOC106581105 coding downstream 280868 12185034 ~ 12203026 (-)
AMCG00002374 NA coding downstream 312213 12145146 ~ 12171681 (-)
AMCG00002376 NA coding downstream 341550 12140005 ~ 12142344 (-)
AMCG00002389 NA coding upstream 478803 12982829 ~ 12997422 (-)
AMCG00002392 NA coding upstream 528603 13032629 ~ 13044363 (-)
AMCG00002398 NA coding upstream 590038 13094064 ~ 13102528 (-)
AMCG00002395 NA coding upstream 614454 13118480 ~ 13121283 (-)
AMCG00002399 NA coding upstream 647563 13151589 ~ 13152326 (-)
G122801 NA non-coding downstream 239980 12195920 ~ 12243914 (-)
G122726 NA non-coding downstream 438875 12043315 ~ 12045019 (-)
G122621 NA non-coding downstream 619838 11862903 ~ 11864056 (-)
G122636 NA non-coding downstream 624569 11857391 ~ 11859325 (-)
G122633 NA non-coding downstream 635702 11847081 ~ 11848192 (-)
G122858 NA non-coding upstream 496815 13000841 ~ 13005335 (-)
G122869 NA non-coding upstream 548000 13052026 ~ 13052390 (-)
G122877 NA non-coding upstream 563195 13067221 ~ 13067627 (-)
G122879 NA non-coding upstream 564808 13068834 ~ 13069238 (-)
G122897 NA non-coding upstream 637842 13141868 ~ 13147672 (-)
AMCG00002368 rbm24b,rbm24,rbm24a,LOC106596654,LOC107601977,LOC106517771,LOC105905339 other downstream 477542 11995828 ~ 12006352 (-)
AMCG00002351 NA other downstream 611032 11869607 ~ 11872862 (-)
AMCG00002350 tmem240a,tmem240,LOC107687438,LOC108275582,LOC105898995,LOC107593924,LOC107673083 other downstream 629003 11848470 ~ 11854891 (-)
G122597 NA other downstream 749570 11731617 ~ 11734324 (-)
AMCG00002327 spen,LOC108414948,LOC106565133,LOC107591084,LOC107737540 other downstream 798805 11647911 ~ 11685089 (-)
G122862 NA other upstream 524171 13028197 ~ 13029406 (-)
AMCG00002421 sec61b,LOC102796100 other upstream 1145201 13649227 ~ 13654247 (-)
G123263 NA other upstream 2437234 14941260 ~ 14946311 (-)
G123585 NA other upstream 4332130 16836156 ~ 16839722 (-)
AMCG00002503 NA other upstream 4454136 16958162 ~ 16974301 (-)

Expression


Co-expression Network