G121178 (dhrs3)


Basic Information

Item Value
gene id G121178
gene name dhrs3
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 5202849 ~ 5204614 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU151864
GCCTGAAGTGCTTTTGGAGCGGGACCCTTATTTTTGGACATAGGATGGGGATGAGCAGGCCCACCTGACTCTCATGCCCTGGAACATCTCCGTGTTGGTGTGGAAAGGCAGTACAGTGGTCGTGGCCACGCCTGGGCAGTCCAGCAACCCCAGCGTGAGGCTCTCCATGAAGGCGAACGAGGAGGCTTTGGAGGTGCAGTAGTCGATGGCCCCAGGGATGGAAGAAAGCGATAAGACGGAGTTAATGCAAACCACGTGGCCATTCTGCAGCTCCAGCATCCTCGGCAGAAAGGCCTTGGTCGTCCAGAACTGTCCCAGTGTGTTGATGTGCTGTGATTTTAGGAGGGCATCGTCATCGCTGTCTATTAGACTTTTCCCATGAACCACTGCAGCATTGTTCACGAGTATGGTGACATCTCCCACCCTCTCCCGCACCACCTTGGCTTGCTTGTACACTTCCTCCCTGTTCCCCACATCGCACAGGAAGTAATGGCACTCCGTCCCCATGAGATTGATCTCCTCGCTGGTCTCCTTCAGGCACTTCTCAGTGCGGCCCCACAGGATCAC

Function

symbol description
dhrs3 Predicted to enable NAD-retinol dehydrogenase activity. Predicted to be involved in regulation of retinoic acid receptor signaling pathway and retinoid metabolic process. Predicted to act upstream of or within several processes, including animal organ morphogenesis; negative regulation of retinoic acid receptor signaling pathway; and regulation of ossification. Predicted to be located in endoplasmic reticulum membrane and photoreceptor outer segment membrane. Predicted to be active in lipid droplet.

NR:

description
PREDICTED: short-chain dehydrogenase/reductase 3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU151864 True 567 lncRNA 0.56 3 5202849 5204614

Neighbor

gene id symbol gene type direction distance location
AMCG00002150 vps13d coding upstream 6756 5128059 ~ 5196093 (+)
AMCG00002149 lrrc38,LOC107685631,LOC106582984 coding upstream 112977 5084895 ~ 5089872 (+)
AMCG00002147 LOC106565894,LOC106582986 coding upstream 166064 5034310 ~ 5036785 (+)
AMCG00002148 ephb2,LOC104917933,LOC108439490,LOC102781222 coding upstream 180165 5014750 ~ 5022684 (+)
AMCG00002146 ephb2 coding upstream 202341 4997545 ~ 5000508 (+)
AMCG00002151 NA coding downstream 33697 5238311 ~ 5240700 (+)
AMCG00002159 NA coding downstream 565638 5770252 ~ 5776525 (+)
AMCG00002156 rcc2,LOC107687402,LOC107712686 coding downstream 656824 5861438 ~ 5872711 (+)
AMCG00002161 NA coding downstream 709657 5914271 ~ 5916094 (+)
AMCG00002160 NA coding downstream 715012 5919626 ~ 5938059 (+)
G121176 NA non-coding upstream 387 5201402 ~ 5202462 (+)
G121114 NA non-coding upstream 450515 4749128 ~ 4752334 (+)
G121045 NA non-coding upstream 620569 4581973 ~ 4582280 (+)
G121044 NA non-coding upstream 620970 4580854 ~ 4581879 (+)
G120974 NA non-coding upstream 1115377 4087159 ~ 4087472 (+)
G121187 NA non-coding downstream 23060 5227674 ~ 5228099 (+)
G121198 NA non-coding downstream 39095 5243709 ~ 5275923 (+)
G121228 NA non-coding downstream 269522 5474136 ~ 5570247 (+)
G121402 NA non-coding downstream 1072904 6277518 ~ 6277900 (+)
G121417 NA non-coding downstream 1122583 6327197 ~ 6327481 (+)
AMCG00002098 NA other upstream 1660672 3533814 ~ 3542177 (+)
G120742 NA other upstream 2243374 2956908 ~ 2959475 (+)
AMCG00002076 NA other upstream 2348722 2852154 ~ 2854127 (+)
G120518 NA other upstream 3262033 1924022 ~ 1940816 (+)
AMCG00002019 NA other upstream 4210085 682670 ~ 992764 (+)
AMCG00002152 NA other downstream 14216 5218830 ~ 5226656 (+)
AMCG00002190 acot7 other downstream 1382040 6586654 ~ 6602608 (+)
AMCG00002215 NA other downstream 2189186 7393800 ~ 7411230 (+)
AMCG00002245 NA other downstream 3534157 8738771 ~ 8792478 (+)
AMCG00002272 NA other downstream 4639591 9844205 ~ 9851312 (+)

Expression


Co-expression Network