G121444



Basic Information


Item Value
gene id G121444
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 6407705 ~ 6407915 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU152215
CTGTGGTTGAGGATCCTGTGAATGATCATCCACTCGGGCTTGATGCCATAGCGGTAGAAGCGCTCCTCCATGGCGGCGTACTCCGGGTCTTTGCTCTTCCTCTTCTCGCTCTTCATGTCCTCGTCCCCGGAGCCGTAGTCATACGGCGGCGGCTCGTCCATGTCGTTCTTGCGCTGGTAGTTGCGGTACATCACCGTGTGGTACAGCTCCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU152215 True 211 lncRNA 0.58 1 6407705 6407915
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00002185 rnf207b,LOC108434591,LOC107593377,LOC107712689,LOC106572244 coding downstream 26274 6357657 ~ 6381431 (-)
AMCG00002178 NA coding downstream 145400 6258047 ~ 6262305 (-)
AMCG00002177 NA coding downstream 159836 6247266 ~ 6247869 (-)
AMCG00002172 mrto4,LOC106582960 coding downstream 299221 6106190 ~ 6108484 (-)
AMCG00002173 megf6 coding downstream 321753 6033844 ~ 6085952 (-)
AMCG00002187 NA coding upstream 20450 6428365 ~ 6447619 (-)
AMCG00002191 espn coding upstream 43359 6451274 ~ 6500272 (-)
AMCG00002193 NA coding upstream 258199 6666114 ~ 6667451 (-)
AMCG00002198 NA coding upstream 275117 6683032 ~ 6706524 (-)
AMCG00002196 NA coding upstream 305082 6712997 ~ 6713197 (-)
G121443 rpl22,LOC107737574,LOC107703077,LOC103047485,LOC107593380,LOC108414460 non-coding downstream 21786 6382433 ~ 6385919 (-)
G121403 NA non-coding downstream 129803 6277468 ~ 6277902 (-)
G121384 NA non-coding downstream 194045 6210585 ~ 6213660 (-)
G121288 NA non-coding downstream 469872 5933658 ~ 5937833 (-)
G121274 NA non-coding downstream 533569 5871668 ~ 5874136 (-)
G121445 chd5,LOC107737210,LOC107691315 non-coding upstream 5098 6413013 ~ 6413274 (-)
G121447 NA non-coding upstream 12126 6420041 ~ 6424298 (-)
G121689 NA non-coding upstream 1153162 7561077 ~ 7562747 (-)
G121716 NA non-coding upstream 1249917 7657832 ~ 7658851 (-)
G121718 NA non-coding upstream 1255071 7662986 ~ 7663677 (-)
AMCG00002167 NA other downstream 392312 5975725 ~ 6015393 (-)
G120993 NA other downstream 2187828 4214715 ~ 4219877 (-)
G120927 slc45a1,LOC107756616,LOC106565711,LOC107702000 other downstream 2621161 3784236 ~ 3786544 (-)
G120907 NA other downstream 2691453 3713867 ~ 3716252 (-)
AMCG00002097 NA other downstream 2941244 3407485 ~ 3466461 (-)
AMCG00002223 NA other upstream 1418726 7826641 ~ 7839411 (-)
AMCG00002265 NA other upstream 3200835 9608750 ~ 9620127 (-)
AMCG00002275 ube4b,LOC107681967,LOC107570768 other upstream 3349510 9757425 ~ 9801108 (-)
AMCG00002276 NA other upstream 3422604 9830519 ~ 9833224 (-)
AMCG00002279 NA other upstream 3429003 9836918 ~ 9853075 (-)

Expression


G121444 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network