G124770 (zfpm2)


Basic Information

Item Value
gene id G124770
gene name zfpm2
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 23682013 ~ 23682226 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU156392
GTCGTTAGGTGCATTTCAAGGGCCCGGGCCCCAGAGAAGCTCTTGTTGCACTGCGGGAAAGGGCAAATGCTGGGGGTTTGATGGGGGCTGGTCTCATTTTCCTCCACCACCGTCTCCGGCTCCCTCTGTCTGCCGCTGCAATAGTACATCAGATGGGCCTGCAAATTCCTCTCACTCCTGTACCAGATCCCACATGCCTTGCAAGGGAAGATGT

Function

symbol description
zfpm2 Enables transcription coactivator activity and transcription corepressor activity. Involved in cardiac chamber morphogenesis; negative regulation of fat cell differentiation; and regulation of transcription by RNA polymerase II. Located in nucleoplasm. Implicated in 46,XY sex reversal 9; myelodysplastic syndrome; and tetralogy of Fallot.

NR:

description
PREDICTED: zinc finger protein ZFPM2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU156392 True 214 lncRNA 0.57 1 23682013 23682226

Neighbor

gene id symbol gene type direction distance location
AMCG00002631 NA coding upstream 4576 23652972 ~ 23677437 (+)
AMCG00002630 NA coding upstream 274047 23407566 ~ 23407966 (+)
AMCG00002620 NA coding upstream 614213 23056782 ~ 23067800 (+)
AMCG00002624 NA coding upstream 626297 23043824 ~ 23055716 (+)
AMCG00002619 NA coding upstream 648428 23028636 ~ 23033585 (+)
AMCG00002635 lrp12,LOC107754924,LOC107714470,LOC107689529 coding downstream 285352 23967578 ~ 23985386 (+)
AMCG00002637 dpys coding downstream 315021 23997247 ~ 24007711 (+)
AMCG00002636 dpys,LOC107686378 coding downstream 337278 24019504 ~ 24036531 (+)
AMCG00002642 NA coding downstream 687658 24369884 ~ 24376014 (+)
AMCG00002646 NA coding downstream 824067 24506293 ~ 24517840 (+)
G124750 NA non-coding upstream 75174 23606537 ~ 23606839 (+)
G124740 NA non-coding upstream 245693 23421973 ~ 23436320 (+)
G124687 NA non-coding upstream 405238 23218330 ~ 23276775 (+)
G124668 NA non-coding upstream 670013 23011435 ~ 23012000 (+)
G124667 NA non-coding upstream 678761 23002991 ~ 23003252 (+)
G124774 NA non-coding downstream 147444 23829670 ~ 23829984 (+)
G124783 NA non-coding downstream 305476 23987702 ~ 24004361 (+)
G124823 NA non-coding downstream 579322 24261548 ~ 24261841 (+)
G124831 NA non-coding downstream 596208 24278434 ~ 24278640 (+)
G124856 NA non-coding downstream 705683 24387909 ~ 24392351 (+)
G124769 NA other upstream 628 23677935 ~ 23681385 (+)
G124689 NA other upstream 391478 23152648 ~ 23290535 (+)
AMCG00002623 sqle,LOC106579093,LOC106605546,LOC107686341 other upstream 501970 23068124 ~ 23180043 (+)
AMCG00002622 NA other upstream 691849 22987545 ~ 22990164 (+)
AMCG00002573 NA other upstream 3348983 20241848 ~ 20333030 (+)
G124863 NA other downstream 740026 24422252 ~ 24422613 (+)
AMCG00002650 NA other downstream 1079658 24761884 ~ 24776815 (+)
AMCG00002661 znf706,LOC103394271,LOC100712275,LOC103364770,LOC106534503,LOC107088369 other downstream 1692716 25374942 ~ 25384312 (+)
AMCG00002684 rpl30,LOC107702100,LOC107568279 other downstream 2593088 26275314 ~ 26279137 (+)
G125219 NA other downstream 2679986 26362212 ~ 26369525 (+)

Expression


Co-expression Network