AMCG00002822 (grid1b,grid1,LOC102791605,LOC107598047,LOC107563625)


Basic Information

Item Value
gene id AMCG00002822
gene name grid1b,grid1,LOC102791605,LOC107598047,LOC107563625
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 3561352 ~ 3562149 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002822
ATGCAGCTCCTCTCGGTGGGAGATGACAGAAAGGAAACAGATAACAGGAGAGCCTGCGAGCTTATGACGCAGGGCATCCTGGCGCTGGTGACGTCGACGGGCTGCGCCTCGGCCAGCGCGCTGCAGTCGCTCACGGACGCCATGCACATCCCGCACCTCTTCGTCCAGCGCAACAACGAGGGCTCCCCCCGCACCGCCTGCCAGCTCAACCCCAGCCCCGACGGCGAGAGGTACACGCTGGCCGCCCGCCCCCCCGTGCGGCTCAACGACGTCATGCTCAAACTGGTCACCGAGCTGCGTTGGCAGAAGTTCATCGTCTTCTACGACAGCGAATACGGTGAGGCTGCCGGGCTGCTGGGGGACGTGGGGACGGGTAGATAA

Function

symbol description
grid1b Predicted to enable glutamate receptor activity and transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential. Predicted to be involved in glutamatergic synaptic transmission and modulation of chemical synaptic transmission. Predicted to act upstream of or within ion transport. Predicted to be located in membrane and synapse. Predicted to be integral component of membrane. Predicted to be active in postsynaptic membrane. Orthologous to human GRID1 (glutamate ionotropic receptor delta type subunit 1).
grid1 Predicted to enable glutamate receptor activity; identical protein binding activity; and transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential. Predicted to be involved in glutamatergic synaptic transmission; modulation of chemical synaptic transmission; and social behavior. Located in extracellular exosome.

NR:

description
PREDICTED: glutamate receptor ionotropic, delta-1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002822 True 381 mRNA 0.65 2 3561352 3562149

Neighbor

gene id symbol gene type direction distance location
AMCG00002821 NA coding upstream 125760 3435143 ~ 3435592 (+)
AMCG00002815 LOC107659261 coding upstream 185184 3358793 ~ 3376168 (+)
AMCG00002816 LOC106607591 coding upstream 212586 3348182 ~ 3348766 (+)
AMCG00002814 NA coding upstream 294319 3257046 ~ 3267033 (+)
AMCG00002810 NA coding upstream 362851 3195140 ~ 3198501 (+)
AMCG00002823 LOC105909129 coding downstream 115493 3677642 ~ 3681292 (+)
AMCG00002825 grid1b,grid1 coding downstream 137420 3699569 ~ 3707678 (+)
AMCG00002826 NA coding downstream 148863 3711012 ~ 3711317 (+)
AMCG00002827 NA coding downstream 408963 3971112 ~ 3974319 (+)
AMCG00002834 NA coding downstream 438141 4000290 ~ 4006473 (+)
G138871 NA non-coding upstream 183325 3376246 ~ 3378027 (+)
G138816 NA non-coding upstream 383742 3172907 ~ 3177610 (+)
G138719 NA non-coding upstream 869512 2691429 ~ 2691840 (+)
G138712 NA non-coding upstream 893814 2665458 ~ 2667538 (+)
G138634 NA non-coding upstream 1097716 2461638 ~ 2463636 (+)
G138903 NA non-coding downstream 165348 3727497 ~ 3727731 (+)
G138905 NA non-coding downstream 363020 3925169 ~ 3928654 (+)
G138927 NA non-coding downstream 427775 3989924 ~ 3990348 (+)
G138940 NA non-coding downstream 462293 4024442 ~ 4024745 (+)
G138946 NA non-coding downstream 510132 4072281 ~ 4076788 (+)
G138790 bub3,LOC106575478,LOC106577429,LOC107684575 other upstream 445271 3107458 ~ 3116081 (+)
AMCG00002784 NA other upstream 1066758 2492086 ~ 2494594 (+)
AMCG00002762 NA other upstream 2151264 1406611 ~ 1410088 (+)
G138506 NA other upstream 2158923 1401289 ~ 1402429 (+)
G138476 NA other upstream 2463877 1095939 ~ 1097475 (+)
G138941 NA other downstream 467375 4029524 ~ 4029924 (+)
G139176 NA other downstream 1534582 5096731 ~ 5098744 (+)
G139492 NA other downstream 2585599 6147748 ~ 6153120 (+)
AMCG00002939 ube2d1,ube2d1b,LOC105891213,LOC106607701,LOC103397267,LOC103397347,LOC105010549,LOC107717106,LOC107553913,LOC107733527 other downstream 3504706 7066855 ~ 7073538 (+)
G139720 LOC103376252,LOC104927182,LOC102078543,LOC101474510 other downstream 3814538 7376687 ~ 7379487 (+)

Expression


Co-expression Network