AMCG00002861 (march5,LOC107549154)


Basic Information

Item Value
gene id AMCG00002861
gene name march5,LOC107549154
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 4850790 ~ 4867571 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002861
ATGGCGGATCACAATGCGGTGGTAATACAGCAGGTTTTGGACAGGAGTTGCTGGGTGTGCTTCGCCACGGACGAGGACGACCGCACGGCCGAGTGGGTCAGGCCCTGCCGGTGTCGGGGCTCCACCAAGTGGGTCCACCAGGCCTGCCTGCAGCGCTGGGTGGACGAGAAGCAGAGGGGCAACAGCACGGCCCGGGTGGCCTGTCCGCAGTGCAATGCAGAATACCTCATAGTGTTCCCCAAGCTAGGAGCCAGCCTGCATGGAGGCCGACAACACCGCGAAACACCAAACACTGCCGAAAGGCGCGTGGCTTCGGCAGCCGTGTCCTCTCCCAGTCGCTCTCGGCAGGGCCTCGGTCACGGGGAAGCCCCTGACTGGCAACTCTGA

Function

symbol description
march5 Predicted to enable zinc ion binding activity. Acts upstream of or within convergent extension. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in central nervous system; eye; and optic vesicle. Orthologous to human MARCHF5 (membrane associated ring-CH-type finger 5).

NR:

description
E3 ubiquitin-protein ligase MARCH5

GO:

id name namespace
GO:0008270 zinc ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002861 True 387 mRNA 0.64 3 4850790 4867571

Neighbor

gene id symbol gene type direction distance location
AMCG00002858 btaf1,LOC107679172,LOC106604898 coding upstream 54486 4775371 ~ 4796304 (+)
AMCG00002852 LOC107562385,LOC104957417 coding upstream 83114 4763141 ~ 4767676 (+)
AMCG00002853 NA coding upstream 102649 4734674 ~ 4748141 (+)
AMCG00002849 NA coding upstream 276624 4568555 ~ 4574166 (+)
AMCG00002847 LOC104962727 coding upstream 286249 4533786 ~ 4564541 (+)
AMCG00002857 march5,LOC107586100,LOC107549154,LOC107676368 coding downstream 7312 4874883 ~ 4877336 (+)
AMCG00002863 LOC104965006 coding downstream 40930 4908501 ~ 4918521 (+)
AMCG00002862 NA coding downstream 60859 4928430 ~ 4933205 (+)
AMCG00002864 NA coding downstream 84529 4952100 ~ 4952405 (+)
AMCG00002866 exoc6,LOC107695547,LOC107654070 coding downstream 96386 4963957 ~ 5008745 (+)
G139084 cpeb3 non-coding upstream 48546 4798613 ~ 4802244 (+)
G139044 NA non-coding upstream 137965 4626657 ~ 4712825 (+)
G139038 NA non-coding upstream 266623 4583865 ~ 4584167 (+)
G138946 NA non-coding upstream 774002 4072281 ~ 4076788 (+)
G138940 NA non-coding upstream 826045 4024442 ~ 4024745 (+)
G139170 NA non-coding downstream 199901 5067472 ~ 5068895 (+)
G139205 NA non-coding downstream 371779 5239350 ~ 5239490 (+)
G139238 NA non-coding downstream 498864 5366435 ~ 5366683 (+)
G139263 cdk1,LOC106607826,LOC100136692 non-coding downstream 572206 5439777 ~ 5442279 (+)
G139351 NA non-coding downstream 950481 5818052 ~ 5819125 (+)
G138941 NA other upstream 820866 4029524 ~ 4029924 (+)
G138888 grid1,LOC106607602 other upstream 1254682 3428689 ~ 3596108 (+)
G138790 bub3,LOC106575478,LOC106577429,LOC107684575 other upstream 1734709 3107458 ~ 3116081 (+)
AMCG00002784 NA other upstream 2356196 2492086 ~ 2494594 (+)
AMCG00002762 NA other upstream 3440702 1406611 ~ 1410088 (+)
G139176 NA other downstream 229160 5096731 ~ 5098744 (+)
G139492 NA other downstream 1280177 6147748 ~ 6153120 (+)
AMCG00002939 ube2d1,ube2d1b,LOC105891213,LOC106607701,LOC103397267,LOC103397347,LOC105010549,LOC107717106,LOC107553913,LOC107733527 other downstream 2199284 7066855 ~ 7073538 (+)
G139720 LOC103376252,LOC104927182,LOC102078543,LOC101474510 other downstream 2509116 7376687 ~ 7379487 (+)
AMCG00002960 NA other downstream 3041681 7909252 ~ 7920908 (+)

Expression


Co-expression Network