AMCG00003006 (adka)


Basic Information

Item Value
gene id AMCG00003006
gene name adka
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 9371373 ~ 9384002 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003006
ATGCAAGGTGCGCTCTTCTTTCTACAGACAGAAGATATCAAGGAAATCGCGAAGAAGGCACAGAGTCTGCCAAAGGTGAACAAGAAGAGGCAGCGAATCGTAGTCTTCACCCAGGGGAAGGACGGCACAGTGGTGACAAGTGGTGATGAAGTTATGATGTTCCCTGTCTTAGAAATTGAGCAGAGTGAAATTGTGGATACTAATGGGGCAGGAGATGCATTTGTGGGAGGTTTTCTGTCACAGCTTGTTCAGGACCGCCCTCTGGAACAATGCATTCGTGCTGGACACTATGCGGCCAACGTCATCATCCGGCGTGCGGGATGCACATTCCCCGAGAAGCCAGACTTTCACTGA

Function

symbol description
adka Predicted to enable adenosine kinase activity. Predicted to be involved in AMP salvage. Predicted to act upstream of or within phosphorylation and purine ribonucleoside salvage. Predicted to be active in cytosol and nucleus. Is expressed in several structures, including digestive system; fin; immature eye; nervous system; and periderm. Human ortholog(s) of this gene implicated in hypermethioninemia due to adenosine kinase deficiency. Orthologous to human ADK (adenosine kinase).

NR:

description
Adka protein

GO:

id name namespace
GO:0006166 purine ribonucleoside salvage biological_process
GO:0016310 phosphorylation biological_process
GO:0016773 phosphotransferase activity, alcohol group as acceptor molecular_function
GO:0004001 adenosine kinase activity molecular_function

KEGG:

id description
K00856 E2.7.1.20, ADK; adenosine kinase

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003006 True 354 mRNA 0.50 3 9371373 9384002

Neighbor

gene id symbol gene type direction distance location
AMCG00003000 kat6b,LOC102792766 coding downstream 24475 9325459 ~ 9346898 (-)
AMCG00002999 samd8 coding downstream 72654 9284549 ~ 9298719 (-)
AMCG00003001 vdac2,LOC108444242,LOC107747461,LOC107582506,LOC107690181 coding downstream 90136 9274213 ~ 9281237 (-)
AMCG00002993 NA coding downstream 404224 8910435 ~ 8967149 (-)
AMCG00002988 NA coding downstream 791000 8571588 ~ 8580373 (-)
AMCG00003003 LOC103355368,LOC107084594,LOC107666490,LOC107601874 coding upstream 50058 9434060 ~ 9440740 (-)
AMCG00003004 vcl,LOC108426801 coding upstream 117243 9501245 ~ 9524893 (-)
AMCG00003005 NA coding upstream 161996 9545998 ~ 9554667 (-)
AMCG00003012 NA coding upstream 223780 9607782 ~ 9621040 (-)
AMCG00003010 gcp2,tubgcp2,LOC106589265 coding upstream 237878 9621880 ~ 9629686 (-)
G140016 NA non-coding downstream 128386 9237868 ~ 9242987 (-)
G140014 NA non-coding downstream 135071 9236022 ~ 9236302 (-)
G140009 znf503,LOC107708443,LOC101070189 non-coding downstream 214811 9150816 ~ 9156562 (-)
G140007 NA non-coding downstream 438404 8932770 ~ 8932969 (-)
G140005 NA non-coding downstream 520814 8849669 ~ 8850559 (-)
G140093 NA non-coding upstream 156342 9540344 ~ 9540553 (-)
G140174 NA non-coding upstream 356652 9740654 ~ 9740940 (-)
G140199 NA non-coding upstream 381651 9765653 ~ 9771507 (-)
G140217 NA non-coding upstream 464893 9848895 ~ 9853413 (-)
G140228 NA non-coding upstream 505156 9889158 ~ 9889626 (-)
G140015 NA other downstream 133643 9236658 ~ 9237730 (-)
G140006 NA other downstream 523533 8847032 ~ 8847840 (-)
G139933 LOC108443181 other downstream 876777 8485361 ~ 8494596 (-)
AMCG00002970 cj104,anapc16 other downstream 1433132 7931166 ~ 7938241 (-)
AMCG00002945 NA other downstream 2018552 7348811 ~ 7352821 (-)
AMCG00003017 NA other upstream 212941 9596943 ~ 9607316 (-)
AMCG00003049 NA other upstream 917798 10301800 ~ 10331372 (-)
AMCG00003110 LOC107699307,LOC108442385,LOC108263686,LOC107727357,LOC105890865,LOC104955882 other upstream 2224461 11608463 ~ 11622649 (-)
G140758 NA other upstream 2256814 11640816 ~ 11647619 (-)
G140757 NA other upstream 2310004 11694006 ~ 11733762 (-)

Expression


Co-expression Network