AMCG00003075 (hpse2,LOC107747298,LOC107665577)


Basic Information

Item Value
gene id AMCG00003075
gene name hpse2,LOC107747298,LOC107665577
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 10818904 ~ 10824933 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003075
ATGGTGATGCCACAGCACTGCCTCTCCCCCGTCTTCGGCTCTTCTCTGTGGTTGGCATCCATTGCTTTGATGGTGCAGCCCTTGATGTCCTCCTCAGCAGCTACCTACAAGAGACCCGTGTCGGGGGGGACAGGACAGGGCTTCATGGACAGGACTCTGATTCTCCTGGACGTGAACACACGGAGCCCACTGAAGACGCTAAATGAAAATTTCCTTTCCTTGCAATTGGACCCTTCGATCATTAAAGACGGATGGCTCGACTTCCTAAGCTCCAAGCGGCTGGTGACACTTGCGAGGGGACTTTCTCCAGCCTATCTGAGGTTCGGAGGCAAGAGGACAGACTTTCTTCAGTTTCACAATCTGAAGAATCTGGCCAAAAGCAGAGGGGGCCCAGGGCCAGACTACTACCTGAAGAACTATGAAGATGATATTGTGCGGAGTGACATTGCCCTGGACAAGCAGAAGGGCTGTAAGCTGGCCAACCACCCTGACATCATGCTGGAGCTGCAGAGGGAGAAGGCTGCTCAGATGCAGCTGGTACTCCTAAAGGAGCAATTATCCAACATCTACAGCAACATCACAATAACA

Function

symbol description
hpse2 Predicted to enable hydrolase activity, acting on glycosyl bonds. Predicted to be located in membrane. Predicted to be active in extracellular matrix. Is expressed in liver. Human ortholog(s) of this gene implicated in urofacial syndrome. Orthologous to human HPSE2 (heparanase 2 (inactive)).

NR:

description
PREDICTED: inactive heparanase-2 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003075 True 588 mRNA 0.52 3 10818904 10824933

Neighbor

gene id symbol gene type direction distance location
AMCG00003070 got1,LOC105006879,LOC107601049,LOC107665595 coding upstream 31349 10781001 ~ 10787555 (+)
AMCG00003064 slc25a28,LOC107601050 coding upstream 98966 10705633 ~ 10719938 (+)
AMCG00003065 NA coding upstream 124930 10686270 ~ 10693974 (+)
AMCG00003057 NA coding upstream 196756 10612506 ~ 10622148 (+)
AMCG00003058 LOC108443489,LOC103368019,LOC108258460 coding upstream 253286 10543469 ~ 10565618 (+)
AMCG00003076 hpse2,LOC107747298,LOC107665577,LOC107702736,LOC107586094 coding downstream 35765 10860698 ~ 10862116 (+)
AMCG00003077 NA coding downstream 41706 10866639 ~ 10881830 (+)
AMCG00003073 NA coding downstream 75882 10900815 ~ 10907710 (+)
AMCG00003074 NA coding downstream 90684 10915617 ~ 10918044 (+)
AMCG00003072 LOC108414772 coding downstream 97663 10922596 ~ 10941584 (+)
G140436 NA non-coding upstream 161913 10653333 ~ 10656991 (+)
G140435 loxl4,LOC103368016 non-coding upstream 186415 10632263 ~ 10632489 (+)
G140434 NA non-coding upstream 191022 10624763 ~ 10627882 (+)
G140351 NA non-coding upstream 528969 10288437 ~ 10289935 (+)
G140340 ubtd1b,LOC106578996 non-coding upstream 567379 10247835 ~ 10251525 (+)
G140612 NA non-coding downstream 382573 11207506 ~ 11209502 (+)
G140632 eif4e1c,LOC108444323,LOC103032634,LOC107708453,LOC107690176 non-coding downstream 420323 11245256 ~ 11247278 (+)
G140692 NA non-coding downstream 655872 11480805 ~ 11481037 (+)
G140694 NA non-coding downstream 663297 11488230 ~ 11490662 (+)
G140723 NA non-coding downstream 712714 11537647 ~ 11537954 (+)
G140478 nkx23,LOC106591187,LOC101065636,LOC101073339,LOC101063040,LOC104962797 other upstream 62064 10754901 ~ 10756840 (+)
AMCG00003066 LOC105931228,LOC105012084,LOC107588449,LOC107706116,LOC108435714,LOC103374338,LOC103154480 other upstream 135292 10680771 ~ 10683612 (+)
AMCG00003019 NA other upstream 965451 9844776 ~ 9853453 (+)
G140189 NA other upstream 1038452 9778250 ~ 9780452 (+)
G140030 NA other upstream 1488440 9325488 ~ 9330464 (+)
G140613 NA other downstream 384640 11209573 ~ 11212111 (+)
G140693 NA other downstream 661258 11486191 ~ 11487884 (+)
AMCG00003129 rab11fip2,LOC107585298,LOC107733785 other downstream 1547066 12371999 ~ 12678159 (+)
G140939 NA other downstream 1905798 12730731 ~ 12739767 (+)
AMCG00003141 LOC105923605 other downstream 2053752 12878685 ~ 12882998 (+)

Expression


Co-expression Network