AMCG00003076 (hpse2,LOC107747298,LOC107665577,LOC107702736,LOC107586094)


Basic Information

Item Value
gene id AMCG00003076
gene name hpse2,LOC107747298,LOC107665577,LOC107702736,LOC107586094
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 10860698 ~ 10862116 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003076
AGGTCTTTAGACAAACTCTACAACTTTGCCGACTGTGCCGGGCTGCACCTGATTTTTGGGCTCAACGCCTTCCATCGGAACCCTGACAACTCCTGGAACGGATCCAGAGCACTCGGTCTGCTCAAGTACAGCGCCGGCAAGAAGTACAACCTCTCCTGGGAGCTGGGCAATGAACCCAACAGTTATCGTGCCATGGTGTCACGCGCTCTCAACAGCAGCCAGCTGGCACAGGACTATACCCAGCTCAGGACTCTGCTGCAGTCTGTGCGTTACTACAGCCGTGCCAACCTCTATGGGCCCAACATCGGACGGCCGCGCAAAAATGCCATCCTGCTGTTGGATGGGTGA

Function

symbol description
hpse2 Predicted to enable hydrolase activity, acting on glycosyl bonds. Predicted to be located in membrane. Predicted to be active in extracellular matrix. Is expressed in liver. Human ortholog(s) of this gene implicated in urofacial syndrome. Orthologous to human HPSE2 (heparanase 2 (inactive)).

NR:

description
PREDICTED: inactive heparanase-2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003076 True 348 mRNA 0.56 2 10860698 10862116

Neighbor

gene id symbol gene type direction distance location
AMCG00003075 hpse2,LOC107747298,LOC107665577 coding upstream 35765 10818904 ~ 10824933 (+)
AMCG00003070 got1,LOC105006879,LOC107601049,LOC107665595 coding upstream 73143 10781001 ~ 10787555 (+)
AMCG00003064 slc25a28,LOC107601050 coding upstream 140760 10705633 ~ 10719938 (+)
AMCG00003065 NA coding upstream 166724 10686270 ~ 10693974 (+)
AMCG00003057 NA coding upstream 238550 10612506 ~ 10622148 (+)
AMCG00003077 NA coding downstream 4523 10866639 ~ 10881830 (+)
AMCG00003073 NA coding downstream 38699 10900815 ~ 10907710 (+)
AMCG00003074 NA coding downstream 53501 10915617 ~ 10918044 (+)
AMCG00003072 LOC108414772 coding downstream 60480 10922596 ~ 10941584 (+)
AMCG00003084 NA coding downstream 97863 10959979 ~ 10961493 (+)
G140436 NA non-coding upstream 203707 10653333 ~ 10656991 (+)
G140435 loxl4,LOC103368016 non-coding upstream 228209 10632263 ~ 10632489 (+)
G140434 NA non-coding upstream 232816 10624763 ~ 10627882 (+)
G140351 NA non-coding upstream 570763 10288437 ~ 10289935 (+)
G140340 ubtd1b,LOC106578996 non-coding upstream 609173 10247835 ~ 10251525 (+)
G140612 NA non-coding downstream 345390 11207506 ~ 11209502 (+)
G140632 eif4e1c,LOC108444323,LOC103032634,LOC107708453,LOC107690176 non-coding downstream 383140 11245256 ~ 11247278 (+)
G140692 NA non-coding downstream 618689 11480805 ~ 11481037 (+)
G140694 NA non-coding downstream 626114 11488230 ~ 11490662 (+)
G140723 NA non-coding downstream 675531 11537647 ~ 11537954 (+)
G140478 nkx23,LOC106591187,LOC101065636,LOC101073339,LOC101063040,LOC104962797 other upstream 103858 10754901 ~ 10756840 (+)
AMCG00003066 LOC105931228,LOC105012084,LOC107588449,LOC107706116,LOC108435714,LOC103374338,LOC103154480 other upstream 177086 10680771 ~ 10683612 (+)
AMCG00003019 NA other upstream 1007245 9844776 ~ 9853453 (+)
G140189 NA other upstream 1080246 9778250 ~ 9780452 (+)
G140030 NA other upstream 1530234 9325488 ~ 9330464 (+)
G140613 NA other downstream 347457 11209573 ~ 11212111 (+)
G140693 NA other downstream 624075 11486191 ~ 11487884 (+)
AMCG00003129 rab11fip2,LOC107585298,LOC107733785 other downstream 1509883 12371999 ~ 12678159 (+)
G140939 NA other downstream 1868615 12730731 ~ 12739767 (+)
AMCG00003141 LOC105923605 other downstream 2016569 12878685 ~ 12882998 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000012_02413852_02502617 HPSE2 coding CI01000012 null 2413852 ~ 2502617 (-)
mexican tetra (Astyanax mexicanus) G314704 LOC107682684 non-coding NW_019172868.1 APWO02000067.1 2116507 ~ 2131133 (-)