AMCG00003312 (neurl1,LOC107676877,LOC107746293)


Basic Information

Item Value
gene id AMCG00003312
gene name neurl1,LOC107676877,LOC107746293
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 19185133 ~ 19195816 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003312
ATGCAGGATTCTCTCGGTGGTCCGTTCCCTGCCACCTCTCATCGATGTCATCACAAGCCCAAGCGCTGCCTCCCCATCCAGCCATGTGGGGGGTTCCCGGTCAGCCCCCTGCTCTTCCACCCCAATGCCAAGGGCTCCCAGATTGTCATGGACCTGGCCCAAAAGGCTGTCAAGAGGCAGGCCAGCTTCTGCAATGCCATAACCTTCAGCAACCGGCCTGTGGTGCTTTACGAGCAGGTCAGACTCAAGATCACAAAGAAGCAGTGCTGCTGGAGTGGGGCTCTACGGCTTGGCTTCACTGCCAAGGACCCGTCCCGGATTAACCCCGACAGCCTGCCCAAGTACGCCTGCCCTGACCTGGTGTCCCAGAGCGGCTTCTGGGCCAAGGCTCTGCCCGAGGAGTTTGCCAATGAGGGCAACATCATCGCCTTCTGGGTAGACAAGAAGGGCCGCGTCTTCTACCGAGTCAATGATTCCAGCCCCATGCTTTTCTTCAGCGGAGTGCGAACCACTGAACCTCTCTGGGCCCTCATTGATGTCTATGGACTAACCAGAGGGGTACAGCTGCTTGGCATAATCTGA

Function

symbol description
neurl1 Predicted to enable translation factor activity, non-nucleic acid binding and ubiquitin protein ligase activity. Involved in negative regulation of Notch signaling pathway; negative regulation of cell population proliferation; and positive regulation of apoptotic process. Located in plasma membrane.

NR:

description
PREDICTED: E3 ubiquitin-protein ligase NEURL1 isoform X2

GO:

id name namespace
GO:0008270 zinc ion binding molecular_function

KEGG:

id description
K01931 NEUR; protein neuralized

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003312 True 582 mRNA 0.58 4 19185133 19195816

Neighbor

gene id symbol gene type direction distance location
AMCG00003306 LOC106586852,LOC105012299,LOC107729347,LOC107746059 coding upstream 691343 18439507 ~ 18493790 (+)
AMCG00003305 NA coding upstream 845298 18306046 ~ 18339835 (+)
AMCG00003302 xpnpep1,LOC106512107,LOC106589391 coding upstream 1111992 18061436 ~ 18073141 (+)
AMCG00003301 NA coding upstream 1126118 18040775 ~ 18059015 (+)
AMCG00003295 smndc1 coding upstream 1288428 17892223 ~ 17896705 (+)
AMCG00003311 LOC103355274,LOC101166281 coding downstream 14767 19210583 ~ 19224956 (+)
AMCG00003315 slk coding downstream 219876 19415692 ~ 19454966 (+)
AMCG00003316 NA coding downstream 373988 19569804 ~ 19573974 (+)
AMCG00003321 NA coding downstream 392818 19588634 ~ 19605421 (+)
AMCG00003322 NA coding downstream 414938 19610754 ~ 19614023 (+)
G142086 NA non-coding upstream 342404 18842454 ~ 18842729 (+)
G142085 NA non-coding upstream 344380 18835540 ~ 18840753 (+)
G142083 NA non-coding upstream 427946 18756913 ~ 18757187 (+)
G142062 NA non-coding upstream 688856 18494924 ~ 18496277 (+)
G142014 NA non-coding upstream 1184698 17939861 ~ 18000435 (+)
G142146 NA non-coding downstream 316667 19512483 ~ 19513132 (+)
G142170 NA non-coding downstream 335596 19531412 ~ 19531867 (+)
G142174 NA non-coding downstream 345226 19541042 ~ 19541247 (+)
G142194 NA non-coding downstream 398062 19593878 ~ 19594267 (+)
G142205 NA non-coding downstream 420445 19616261 ~ 19616567 (+)
G142078 NA other upstream 492929 18588574 ~ 18692204 (+)
AMCG00003291 bbip1 other upstream 1459752 17721244 ~ 17725381 (+)
G141962 NA other upstream 1506611 17676279 ~ 17678522 (+)
AMCG00003256 NA other upstream 2625927 16527189 ~ 16559206 (+)
AMCG00003257 ablim1 other upstream 2684139 16464294 ~ 16500994 (+)
G142172 NA other downstream 339877 19535693 ~ 19537091 (+)
AMCG00003323 rnf122,si:dkey-51a16.9,LOC104925894,LOC103353499,LOC106606324 other downstream 423065 19618881 ~ 19633150 (+)
AMCG00003324 NA other downstream 455360 19651176 ~ 19658477 (+)

Expression


Co-expression Network