AMCG00003376


Basic Information

Item Value
gene id AMCG00003376
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 22985672 ~ 22986067 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003376
ATGAAGCTGGAGAGTTTGGGGATGATCCACACCGACCTCAAGCCCGACAACATTATGCTGGTGGACTCAGCCAGGCAGCCCCTCCGAGTCAAGCTGATTGACTTCGGCCTGGCCATCCATGTCTCGGAGGCAGTGTGCTCTGACTGTGTGGAGGCCACATATTTCAGGGCTCCAGAGATCATCCTTGGCCTGCACTACAATCAAGCCATCGATATGTGGTCGCTGGGCTGCATCATTGCGGAGCTGTTTCTGGGTTGGCCTCTGTACCCCACGGCATCGGTGTACGATCAAATCCGCTACATTGTTGAGATGCAGGGTTTGCCTGCTAAGAACCTGCTAAGTGCCGGGACCAAGACAGGAGAGTTCTTTAAGAGGGACTCGGCCGACTCTCTGTGA

Function

GO:

id name namespace
GO:0006468 protein phosphorylation biological_process
GO:0045634 regulation of melanocyte differentiation biological_process
GO:0005524 ATP binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003376 True 396 mRNA 0.55 1 22985672 22986067

Neighbor

gene id symbol gene type direction distance location
AMCG00003377 NA coding downstream 34 22980500 ~ 22985638 (-)
AMCG00003375 NA coding downstream 152162 22832189 ~ 22833510 (-)
AMCG00003373 NA coding downstream 877590 22104127 ~ 22108082 (-)
AMCG00003367 LOC107084148,LOC107376893,LOC102788851 coding downstream 965658 21994244 ~ 22020014 (-)
AMCG00003365 NA coding downstream 995252 21968705 ~ 21990420 (-)
G142725 NA non-coding downstream 157212 22828072 ~ 22828460 (-)
G142709 NA non-coding downstream 279161 22702582 ~ 22706511 (-)
G142665 NA non-coding downstream 891044 22091701 ~ 22094628 (-)
G142663 NA non-coding downstream 900481 22084918 ~ 22085191 (-)
G142661 NA non-coding downstream 915690 22066953 ~ 22069982 (-)
AMCG00003337 cnnm2b,borcs7,LOC107738473,LOC107708677,LOC107699104 other downstream 3108910 19802079 ~ 19876762 (-)
AMCG00003320 NA other downstream 3416057 19543637 ~ 19569615 (-)
G141826 NA other downstream 6237241 16748061 ~ 16748431 (-)
AMCG00003231 NA other downstream 7844853 15056643 ~ 15140819 (-)
AMCG00003214 phs,pcbd1,LOC107743500,LOC107601888 other downstream 8311252 14669415 ~ 14674420 (-)

Expression


Co-expression Network