G139506 (stambpl1,LOC107594159,LOC107758441,LOC107683716)


Basic Information

Item Value
gene id G139506
gene name stambpl1,LOC107594159,LOC107758441,LOC107683716
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 6201203 ~ 6201470 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU175447
CCGCCCCTTACGTGATGAACTTGTTATAGAGCACGAAGGCGTTCTCCAGGCTGCCCTCCTCCAGGTACACTGCCGCCATGCGCTCCATCTCCACCCCGGAGCGGAAGTAGCGCCGGGGCGTGATGTCTTCGTTGATCTCGATGTTGCAGCCCATCTTGCTCAGGGCTCGGACCCGCTCCACTGCCGGCAGGCTCACGTCAGTGTGGTCGGGCTCAGCTGCGAGCTTCTTCTGAAAGCAAATCAGAGTCTGCCATAAAAACACTCATCA

Function

symbol description
stambpl1 Predicted to enable Lys63-specific deubiquitinase activity and thiol-dependent deubiquitinase. Predicted to be involved in protein K63-linked deubiquitination. Predicted to act upstream of or within protein deubiquitination. Predicted to be active in endosome and membrane. Orthologous to human STAMBPL1 (STAM binding protein like 1).

NR:

description
PREDICTED: AMSH-like protease isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU175447 True 268 lncRNA 0.59 1 6201203 6201470

Neighbor

gene id symbol gene type direction distance location
AMCG00002916 acta2,LOC106531354,LOC107683715 coding upstream 7703 6189364 ~ 6193500 (+)
AMCG00002909 NA coding upstream 42636 6157773 ~ 6158567 (+)
AMCG00002910 NA coding upstream 68984 6117729 ~ 6132219 (+)
AMCG00002908 LOC107553481,LOC107753437,LOC107669213,LOC107683711,LOC108413682,LOC107715956,LOC105902286 coding upstream 90691 6094105 ~ 6110512 (+)
AMCG00002911 NA coding upstream 109137 6086560 ~ 6092066 (+)
AMCG00002917 NA coding downstream 8258 6209728 ~ 6212571 (+)
AMCG00002918 NA coding downstream 26717 6228187 ~ 6234155 (+)
AMCG00002915 NA coding downstream 53700 6255170 ~ 6266600 (+)
AMCG00002921 atad1,atad1b,LOC106589392,LOC107680273 coding downstream 118666 6320136 ~ 6329764 (+)
AMCG00002925 NA coding downstream 195987 6397457 ~ 6409095 (+)
G139505 NA non-coding upstream 1347 6199359 ~ 6199856 (+)
G139504 NA non-coding upstream 2701 6198270 ~ 6198502 (+)
G139498 NA non-coding upstream 4173 6194611 ~ 6197030 (+)
G139488 NA non-coding upstream 60532 6138121 ~ 6140671 (+)
G139351 NA non-coding upstream 382078 5818052 ~ 5819125 (+)
G139507 NA non-coding downstream 1374 6202844 ~ 6203059 (+)
G139531 NA non-coding downstream 96264 6297734 ~ 6311270 (+)
G139573 NA non-coding downstream 216968 6418438 ~ 6418798 (+)
G139572 a1cf,LOC107708930,LOC107695528,LOC107654048,LOC107739758 non-coding downstream 218696 6420166 ~ 6423168 (+)
G139633 NA non-coding downstream 861053 7062523 ~ 7066374 (+)
G139492 NA other upstream 48083 6147748 ~ 6153120 (+)
G139176 NA other upstream 1102459 5096731 ~ 5098744 (+)
G138941 NA other upstream 2171279 4029524 ~ 4029924 (+)
G138888 grid1,LOC106607602 other upstream 2605095 3428689 ~ 3596108 (+)
G138790 bub3,LOC106575478,LOC106577429,LOC107684575 other upstream 3085122 3107458 ~ 3116081 (+)
AMCG00002939 ube2d1,ube2d1b,LOC105891213,LOC106607701,LOC103397267,LOC103397347,LOC105010549,LOC107717106,LOC107553913,LOC107733527 other downstream 865385 7066855 ~ 7073538 (+)
G139720 LOC103376252,LOC104927182,LOC102078543,LOC101474510 other downstream 1175217 7376687 ~ 7379487 (+)
AMCG00002960 NA other downstream 1707782 7909252 ~ 7920908 (+)
G139784 NA other downstream 1721712 7923182 ~ 7926832 (+)
AMCG00002965 eif4ebp2,LOC107564345,LOC107668794,LOC107716353 other downstream 1836107 8037577 ~ 8044413 (+)

Expression


Co-expression Network