G141582


Basic Information

Item Value
gene id G141582
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 15217242 ~ 15217551 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU178099
TAGCCACTCATCAAGGAAAGAGCACATTTTACTGGGTAATGATTCTATTGTACAACCAAATGTTGGAGAAGAGACTGAAGGCCTAGCTGAGTGGAAGAACTGTGAACAGGAGTACTTTTTATTTAGTTCAGATGACCACATGAGAGCAAACTAGATAGAAACGCTGGGTCTAAATGATGCACGTGGGCATTATAGGCAAATACATTTCCTGGTAGCCAGCTTAATTGCACCCGAGAGTATTTATTAAACCGTGAAAAGGTAGATACTGGGCTATACCCAGAATATGGCACTGTGCTCTAGTAAAGTGGGT

Function

GO:

id name namespace
GO:1902600 proton transmembrane transport biological_process
GO:0046034 ATP metabolic process biological_process
GO:1905039 carboxylic acid transmembrane transport biological_process
GO:0042773 ATP synthesis coupled electron transport biological_process
GO:0042775 mitochondrial ATP synthesis coupled electron transport biological_process
GO:0006119 oxidative phosphorylation biological_process
GO:0006122 mitochondrial electron transport, ubiquinol to cytochrome c biological_process
GO:0022900 electron transport chain biological_process
GO:0098656 anion transmembrane transport biological_process
GO:0009123 nucleoside monophosphate metabolic process biological_process
GO:0009126 purine nucleoside monophosphate metabolic process biological_process
GO:0009144 purine nucleoside triphosphate metabolic process biological_process
GO:1903825 organic acid transmembrane transport biological_process
GO:0009161 ribonucleoside monophosphate metabolic process biological_process
GO:0009167 purine ribonucleoside monophosphate metabolic process biological_process
GO:1990542 mitochondrial transmembrane transport biological_process
GO:0015718 monocarboxylic acid transport biological_process
GO:0009205 purine ribonucleoside triphosphate metabolic process biological_process
GO:0006839 mitochondrial transport biological_process
GO:0006848 pyruvate transport biological_process
GO:0006850 mitochondrial pyruvate transmembrane transport biological_process
GO:1901475 pyruvate transmembrane transport biological_process
GO:0009055 electron transfer activity molecular_function
GO:0022857 transmembrane transporter activity molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0022890 inorganic cation transmembrane transporter activity molecular_function
GO:0015002 heme-copper terminal oxidase activity molecular_function
GO:0015318 inorganic molecular entity transmembrane transporter activity molecular_function
GO:0015075 ion transmembrane transporter activity molecular_function
GO:0015077 monovalent inorganic cation transmembrane transporter activity molecular_function
GO:0015078 proton transmembrane transporter activity molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function
GO:0016675 oxidoreductase activity, acting on a heme group of donors molecular_function
GO:0016676 oxidoreductase activity, acting on a heme group of donors, oxygen as acceptor molecular_function

KEGG:

id description
ko00190 Oxidative phosphorylation
ko04260 Cardiac muscle contraction
ko04723 Retrograde endocannabinoid signaling
ko04714 Thermogenesis
ko05010 Alzheimer disease
ko05012 Parkinson disease
ko05016 Huntington disease
ko04932 Non-alcoholic fatty liver disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU178099 True 310 lncRNA 0.42 1 15217242 15217551

Neighbor

gene id symbol gene type direction distance location
AMCG00003233 NA coding upstream 828 15204627 ~ 15216414 (+)
AMCG00003238 LOC107736286 coding upstream 39027 15174130 ~ 15178215 (+)
AMCG00003234 NA coding upstream 49268 15163724 ~ 15167974 (+)
AMCG00003242 NA coding upstream 55704 15157133 ~ 15161538 (+)
AMCG00003229 NA coding upstream 70957 15135212 ~ 15146285 (+)
AMCG00003236 NA coding downstream 22950 15240501 ~ 15250404 (+)
AMCG00003237 mxtx1,LOC107666529,LOC108415850 coding downstream 48570 15266121 ~ 15267591 (+)
AMCG00003235 bms1,LOC107566656,LOC107675025,LOC106605356,LOC106581260 coding downstream 50670 15268221 ~ 15284542 (+)
AMCG00003243 tspan14,tsn14,LOC106577130,LOC107743579 coding downstream 71073 15288624 ~ 15301140 (+)
AMCG00003247 NA coding downstream 669565 15887116 ~ 15891866 (+)
G141574 NA non-coding upstream 26897 15189983 ~ 15190345 (+)
G141573 NA non-coding upstream 30917 15186071 ~ 15186325 (+)
G141405 NA non-coding upstream 700732 14462167 ~ 14516510 (+)
G141412 mgea5,LOC106961065,LOC107569412 non-coding upstream 708403 14500971 ~ 14508839 (+)
G141401 NA non-coding upstream 771887 14443857 ~ 14445355 (+)
G141592 NA non-coding downstream 35289 15252840 ~ 15254844 (+)
G141829 NA non-coding downstream 1581408 16798959 ~ 16801312 (+)
G141885 NA non-coding downstream 1814874 17032425 ~ 17035242 (+)
G141955 NA non-coding downstream 2300169 17517720 ~ 17517921 (+)
G141965 NA non-coding downstream 2485621 17703172 ~ 17703460 (+)
AMCG00003207 NA other upstream 611694 14601317 ~ 14605548 (+)
AMCG00003195 NA other upstream 917249 14283850 ~ 14299993 (+)
G141331 NA other upstream 1032599 14180780 ~ 14184643 (+)
AMCG00003182 NA other upstream 1085967 14122783 ~ 14131275 (+)
AMCG00003168 LOC107706030,LOC107743565,LOC107666486 other upstream 1473699 13724910 ~ 13743543 (+)
AMCG00003257 ablim1 other downstream 1246743 16464294 ~ 16500994 (+)
AMCG00003256 NA other downstream 1309638 16527189 ~ 16559206 (+)
G141962 NA other downstream 2458728 17676279 ~ 17678522 (+)
AMCG00003291 bbip1 other downstream 2503693 17721244 ~ 17725381 (+)
G142078 NA other downstream 3371023 18588574 ~ 18692204 (+)

Expression


Co-expression Network