AMCG00003492 (dlgap2)



Basic Information


Item Value
gene id AMCG00003492
gene name dlgap2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 5974945 ~ 5977627 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00003492
ATGCCCAGACCCACCTCCCAAGACCTAGCAGGATTCTGGGACCTTTTGCAGCTTTCCATTGATGATGTCAGCATGAAATTTGATGAGCTGCAGCAGATCAAGAACAATGACTGGAGACCCATTGAAAGTCCAGAAAAGAAGGAGGAGAAAAAATTGCCGCCTCCAGTACCAAAGAAGCCCCCAAAAGGTAAGCCAGGTGTCACACGAGAAAAGTCCCTGGATCTTCCAGACAGGCAGCGGCAAGAAGCTAGAAGACGACTGATGGCAGCCAAGCGGGCGGCTTCCTTTCGGCAGAACTCGGCCACTGAGAGAGCAGACAGCATCGAGATTTACATCCCTGAAGCCCAGACCAGACTTTAA

Function


symbol description
dlgap2 Predicted to enable molecular adaptor activity. Predicted to be involved in regulation of postsynaptic neurotransmitter receptor activity. Predicted to be located in plasma membrane. Predicted to be active in glutamatergic synapse and postsynaptic specialization.

NR:

description
PREDICTED: disks large-associated protein 2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00003492 True 360 mRNA 0.51 2 5974945 5977627

Neighbor


gene id symbol gene type direction distance location
AMCG00003491 NA coding downstream 4961 5914647 ~ 5969984 (-)
AMCG00003490 NA coding downstream 123764 5846898 ~ 5851181 (-)
AMCG00003489 NA coding downstream 241508 5633462 ~ 5733437 (-)
AMCG00003488 kbtbd11 coding downstream 419203 5553481 ~ 5555742 (-)
AMCG00003486 NA coding downstream 561284 5408798 ~ 5413661 (-)
AMCG00003493 LOC103359253 coding upstream 10457 5988084 ~ 5997463 (-)
AMCG00003494 NA coding upstream 165445 6143072 ~ 6144359 (-)
AMCG00003502 fbxo25,LOC107707022,LOC107697951,LOC107593986 coding upstream 669825 6647452 ~ 6656335 (-)
AMCG00003504 NA coding upstream 719328 6696955 ~ 6700531 (-)
AMCG00003503 NA coding upstream 727189 6704816 ~ 6727602 (-)
G982 NA non-coding downstream 19626 5955104 ~ 5955319 (-)
G961 NA non-coding downstream 145196 5829447 ~ 5829749 (-)
G946 NA non-coding downstream 186624 5788068 ~ 5788321 (-)
G942 NA non-coding downstream 219477 5752077 ~ 5755468 (-)
G862 NA non-coding downstream 632958 5340461 ~ 5341987 (-)
G993 NA non-coding upstream 8938 5986565 ~ 5986975 (-)
G998 NA non-coding upstream 309701 6287328 ~ 6287540 (-)
G1114 NA non-coding upstream 841030 6818657 ~ 6825716 (-)
G1117 NA non-coding upstream 864142 6841769 ~ 6851759 (-)
G1147 NA non-coding upstream 1095774 7073401 ~ 7073614 (-)
AMCG00003484 NA other downstream 618477 5344070 ~ 5356468 (-)
AMCG00003476 NA other downstream 1165956 4583142 ~ 4808989 (-)
AMCG00003459 NA other downstream 2079421 3876232 ~ 3895524 (-)
AMCG00003444 NA other downstream 2435978 3536172 ~ 3538967 (-)
G531 adck3,coq8a,LOC107602173,LOC107675039,LOC107727627 other downstream 2544673 3394657 ~ 3430272 (-)
AMCG00003550 NA other upstream 3031490 9009117 ~ 9082850 (-)
AMCG00003572 NA other upstream 3875572 9853199 ~ 9865649 (-)
AMCG00003573 NA other upstream 3897043 9874670 ~ 9878444 (-)
AMCG00003587 naa20 other upstream 4647719 10625346 ~ 10633112 (-)
AMCG00003586 NA other upstream 4973457 10951084 ~ 10956353 (-)

Expression



Co-expression Network