AMCG00003747 (kif26b,LOC102197193,LOC107097817)


Basic Information

Item Value
gene id AMCG00003747
gene name kif26b,LOC102197193,LOC107097817
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 16993119 ~ 16994022 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003747
ATGGCAGATGCTTGCTCTCCAACCAAATCGGCTTCCTTCTCCCCGGAGTCCTGGTACCGGAAAGCCTACGAGGAGTCCCGGACCGGCAGCCGCCCAGCCCCCGAGGGAGCCGGATCGGTGCCCGGTTCGTCCGGAACCCCGTCTCCAGGATCCGGCACTTCTTCTCCCGGGTCCTTCTCGGGCTCCCCGGGTCCCACTTCCCCGGGGATCGGAACAGGGTCCCCCGGCTCTTTGGGCGGCTCCCCCGGGTTCGGCACCGGCTCTCCTGGGTCCGGCAGCGGCAGCTCGCCTGGGTCCGACCGGGGAGTCTGGTGTGAGAACTGCAACGCCAGACTGGTGGAGCTGAAACGACAGGCGCTGAAATTACTGATCCCCGGACCCTTCTCCAGCAAGGTTATTGAGCATTAA

Function

symbol description
kif26b Predicted to enable microtubule binding activity and microtubule motor activity. Predicted to be involved in microtubule-based movement. Predicted to act upstream of or within establishment of cell polarity; positive regulation of cell-cell adhesion; and ureteric bud invasion. Predicted to be located in cytoplasm. Predicted to be part of kinesin complex. Predicted to be active in microtubule.

NR:

description
kinesin-like protein KIF26B

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003747 True 408 mRNA 0.66 2 16993119 16994022

Neighbor

gene id symbol gene type direction distance location
AMCG00003740 kif26b,kif26ba,LOC107682227,LOC107693166 coding downstream 100240 16883972 ~ 16892879 (-)
AMCG00003741 NA coding downstream 111997 16880036 ~ 16881122 (-)
AMCG00003735 NA coding downstream 341617 16644360 ~ 16651502 (-)
AMCG00003736 sccpdh,LOC105911215 coding downstream 395793 16593436 ~ 16597326 (-)
AMCG00003732 NA coding downstream 416532 16570530 ~ 16576587 (-)
AMCG00003748 NA coding upstream 4758 16998780 ~ 17013774 (-)
AMCG00003746 NA coding upstream 49612 17043634 ~ 17047025 (-)
AMCG00003753 NA coding upstream 211291 17205313 ~ 17229181 (-)
AMCG00003754 prox1a,LOC107592773,LOC107752784 coding upstream 281620 17275642 ~ 17291950 (-)
AMCG00003757 rps6kc1 coding upstream 475318 17469340 ~ 17513471 (-)
G2834 NA non-coding downstream 404826 16588069 ~ 16588293 (-)
G2832 NA non-coding downstream 406853 16586062 ~ 16586266 (-)
G2765 NA non-coding downstream 742636 16247935 ~ 16250483 (-)
G2722 NA non-coding downstream 907124 16085115 ~ 16085995 (-)
G2720 NA non-coding downstream 908253 16079399 ~ 16084866 (-)
G2903 NA non-coding upstream 2768 16996790 ~ 16997604 (-)
G2902 NA non-coding upstream 47415 17041437 ~ 17042549 (-)
G2973 NA non-coding upstream 260249 17254271 ~ 17254765 (-)
G2972 NA non-coding upstream 263915 17257937 ~ 17259543 (-)
G3170 odc1,LOC107687948,LOC107753348,LOC107758719,LOC107687839 non-coding upstream 941818 17935840 ~ 17940712 (-)
AMCG00003742 kif26ba,LOC107693166,LOC107682227,LOC107589674,LOC107586651,LOC107729288 other downstream 121644 16868332 ~ 16871475 (-)
AMCG00003734 NA other downstream 364718 16607410 ~ 16628401 (-)
G2665 crim1,LOC107679775,LOC107730201,LOC107602268,LOC107662656,LOC106601300 other downstream 1401389 15515673 ~ 15591730 (-)
G2500 NA other downstream 2181788 14810786 ~ 14811331 (-)
G2373 esrrg other downstream 2980098 14009458 ~ 14013021 (-)
AMCG00003751 NA other upstream 143226 17137248 ~ 17140382 (-)
G3181 NA other upstream 948555 17942577 ~ 17944942 (-)
AMCG00003784 NA other upstream 1141357 18135379 ~ 18142681 (-)
AMCG00003782 ctsb other upstream 1152638 18146660 ~ 18152381 (-)
AMCG00003825 NA other upstream 2367796 19361818 ~ 19373225 (-)

Expression


Co-expression Network