AMCG00003749 (hpcal1,LOC106607246,LOC105015955,LOC107565203)


Basic Information

Item Value
gene id AMCG00003749
gene name hpcal1,LOC106607246,LOC105015955,LOC107565203
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 17104264 ~ 17108278 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003749
ATGGGGAAGCAGAACAGTAAACTTCGTCCTGAGGTGCTGAACGACCTGCGGGAGAACACGGAGTTCACCGACCACGAGCTGCAGGAGTGGTACAAGGGTTTCCTGAAGGACTGCCCCACGGGACACCTGACCGTGGAGGAGTTCAAGAAGATCTACGCCAACTTCTTCCCCTACGGAGACGCCTCCAAGTTCGCCGAGCATGTCTTCCGCACCTTCGACACCAACGGTGACGGCACCATCGACTTCCGGGAGTTCATCATCGCGCTCAGTGTCACGTCACGCGGCAAGCTGGAGCAGAAGCTGAAGTGGGCGTTCAGTATGTACGACCTGGATGGCAACGGCTACATCAGCAGGGCAGAAATGCTCGAGATAGCGATTTACAAGATGGTGTCGTCGGTTATGAAAATGCCAGAAGATGAATCCACTCCGGAGAAGCGCACAGACAAGATCTTTCGCCAAATGGACACAAACAATGACGGTAAACTTTCCCTGGAGGAGTTTATCAAAGGTGCCAAGAGCGACCCCTCCATCGTGCGATTGCTACAGTGTGACCCCAGCAGCGCAAGTCAGTTCTGA

Function

symbol description
hpcal1 Predicted to enable calcium ion binding activity. Orthologous to human HPCAL1 (hippocalcin like 1).

NR:

description
PREDICTED: hippocalcin-like protein 1

GO:

id name namespace
GO:0005509 calcium ion binding molecular_function

KEGG:

id description
K23847 HPCAL1; hippocalcin-like protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003749 True 576 mRNA 0.55 3 17104264 17108278

Neighbor

gene id symbol gene type direction distance location
AMCG00003750 NA coding upstream 16 17078085 ~ 17104248 (+)
AMCG00003745 hnrnpu,LOC107689318,LOC107729300,LOC107693167 coding upstream 74636 17015664 ~ 17029628 (+)
AMCG00003743 NA coding upstream 227019 16872643 ~ 16877245 (+)
AMCG00003739 NA coding upstream 253425 16847794 ~ 16850839 (+)
AMCG00003738 NA coding upstream 404916 16693570 ~ 16699348 (+)
AMCG00003752 NA coding downstream 53462 17161740 ~ 17205182 (+)
AMCG00003755 NA coding downstream 421119 17529397 ~ 17552735 (+)
AMCG00003759 NA coding downstream 468456 17576734 ~ 17577808 (+)
AMCG00003760 dnajc27,LOC106605409,LOC107733160,LOC107752776,LOC107674103 coding downstream 510146 17618424 ~ 17622439 (+)
AMCG00003761 NA coding downstream 521008 17629286 ~ 17640891 (+)
G2861 NA non-coding upstream 170244 16868299 ~ 16934020 (+)
G2836 NA non-coding upstream 504935 16599058 ~ 16599329 (+)
G2833 NA non-coding upstream 506895 16593264 ~ 16597369 (+)
G2797 NA non-coding upstream 673709 16429034 ~ 16430555 (+)
G2755 NA non-coding upstream 872766 16229935 ~ 16231498 (+)
G2945 LOC104942205,LOC105908308,LOC105908357,LOC107592771,LOC107752785 non-coding downstream 99757 17208035 ~ 17210041 (+)
G2967 NA non-coding downstream 145988 17254266 ~ 17256450 (+)
G3265 NA non-coding downstream 1330528 18438806 ~ 18439666 (+)
G3269 NA non-coding downstream 1436706 18544984 ~ 18545538 (+)
G3370 NA non-coding downstream 1837304 18945582 ~ 18946131 (+)
AMCG00003744 NA other upstream 61670 17032570 ~ 17042594 (+)
AMCG00003712 extl3,LOC106571659,LOC106608199 other upstream 1064624 16024871 ~ 16039640 (+)
AMCG00003702 NA other upstream 1786036 15301080 ~ 15318228 (+)
AMCG00003690 NA other upstream 2237506 14851752 ~ 14866758 (+)
G2440 NA other upstream 2684532 14418516 ~ 14419732 (+)
G3047 NA other downstream 573539 17681817 ~ 17683988 (+)
AMCG00003779 ctsb,catb,LOC107381178 other downstream 1023641 18131919 ~ 18142633 (+)
G3108 NA other downstream 1038382 18146660 ~ 18152314 (+)
AMCG00003828 ctgf,ctgfa,moxd1,LOC106571301,LOC107683930,LOC106571350 other downstream 2163687 19271965 ~ 19397686 (+)
G3751 NA other downstream 4440923 21549201 ~ 21549533 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000325_07921827_07924727 HPCL1, HPCAL1.L, NCALD, HPCA.S, HPCAL1, HPCA coding CI01000325 null 7921822 ~ 7924803 (-)