AMCG00003940 (fig4)


Basic Information

Item Value
gene id AMCG00003940
gene name fig4
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 25848161 ~ 25851389 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003940
ATGCCAAAGACCGTTGGAATTGATCCGAGCCCCTTCACTGTTCGCAAACCAGAGGAGACTGGGAAATCAGTGTTAAGCAACAAGAGCAACAAAGAGGAGACTGTTCTACAGAGGAAGACTGCGGCCAGTGCACCCCCCCCGCCCAGCGAAGAAGCCATCTCCAGTAGCTCGGAGGATGACTCTGGGACTGATAAGGAGGAAGAAGGGGCTGTCTCTCAACGCTCCACGCCCATCAAGTTTGCTGACTCAGGAGAAGGCAATCGGACCCAAGAG

Function

symbol description
fig4 Predicted to enable phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity. Predicted to be involved in phosphatidylinositol biosynthetic process. Predicted to act upstream of or within several processes, including negative regulation of myelination; nervous system development; and phosphatidylinositol metabolic process. Located in endosome membrane and lipid droplet. Implicated in Charcot-Marie-Tooth disease type 4J; Yunis-Varon syndrome; amyotrophic lateral sclerosis type 11; and bilateral parasagittal parieto-occipital polymicrogyria.

NR:

description
PREDICTED: polyphosphoinositide phosphatase

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0042578 phosphoric ester hydrolase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003940 True 273 mRNA 0.55 2 25848161 25851389

Neighbor

gene id symbol gene type direction distance location
AMCG00003942 LOC101067178 coding downstream 29186 25811320 ~ 25818975 (-)
AMCG00003929 cdc40 coding downstream 151622 25660330 ~ 25696539 (-)
AMCG00003928 NA coding downstream 256674 25580771 ~ 25591487 (-)
AMCG00003927 NA coding downstream 289813 25553538 ~ 25558348 (-)
AMCG00003920 NA coding downstream 1103971 24713229 ~ 24744190 (-)
AMCG00003941 fig4 coding upstream 22758 25874147 ~ 25884138 (-)
AMCG00003945 NA coding upstream 155461 26006850 ~ 26015600 (-)
AMCG00003952 NA coding upstream 235358 26086747 ~ 26117524 (-)
AMCG00003951 NA coding upstream 304154 26155543 ~ 26214675 (-)
AMCG00003950 NA coding upstream 374077 26225466 ~ 26257039 (-)
G4455 NA non-coding downstream 380728 25466252 ~ 25467433 (-)
G4415 NA non-coding downstream 779919 25063554 ~ 25068242 (-)
G4390 NA non-coding downstream 966552 24820841 ~ 24881609 (-)
G4397 NA non-coding downstream 974275 24868711 ~ 24873886 (-)
G4353 NA non-coding downstream 1212666 24635290 ~ 24635495 (-)
G4602 NA non-coding upstream 426055 26277444 ~ 26279767 (-)
G4624 sec63,LOC106940628 non-coding upstream 508468 26359857 ~ 26365069 (-)
G4660 NA non-coding upstream 682491 26533880 ~ 26586892 (-)
G4665 NA non-coding upstream 707480 26558869 ~ 26561251 (-)
G4727 NA non-coding upstream 906962 26758351 ~ 26758880 (-)
AMCG00003909 NA other downstream 1551915 24263907 ~ 24296246 (-)
AMCG00003896 tmem181 other downstream 2090365 23740585 ~ 23757796 (-)
AMCG00003893 NA other downstream 2314279 23529519 ~ 23533882 (-)
G3523 NA other downstream 6341408 19444016 ~ 19506753 (-)
G3517 LOC101154678 other downstream 6422795 19424963 ~ 19425366 (-)
G4521 fig4 other upstream 46545 25897934 ~ 25901612 (-)
AMCG00003946 NA other upstream 114031 25965420 ~ 25998628 (-)
AMCG00003967 LOC107095448 other upstream 978965 26830354 ~ 26869578 (-)
AMCG00004006 NA other upstream 3473352 29324741 ~ 29329115 (-)
AMCG00004038 LOC105015767 other upstream 4333229 30184618 ~ 30220135 (-)

Expression


Co-expression Network