AMCG00004140 (runx2,LOC107378134,LOC102312376)


Basic Information

Item Value
gene id AMCG00004140
gene name runx2,LOC107378134,LOC102312376
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 35207531 ~ 35210874 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004140
ATGCGCATTCCTGTAGATCCCAGCACCAGCCGGAGGTTCAGCCCCCCGTCCAGCAGCCTCCAGCCGGTCCCCGGGAAAATGAGCGAGGTGAGCGCCGCGCCGGGGCAGCAGGAGGCGGCTCCAGCGGTGCCCAGACTCCGGCCGCACGACAACCGCACCATGGTTGAAATCATCGCCGACCACCCTGCGGAATTAGTGCGGACTGACAGCCCCAATTTCCTCTGCTCTGTCCTGCCGTCACATTGGAGATGTAATAAAACCTTGCCCGTAGCCTTCAAGGTGGTAGCACTTGGAGAAGTGCCTGACGGAACTGTAGTCACAGTGATGGCGGGTAACGACGAGAACTATTCAGCTGAACTAAGAAATGCTTCTGCAGTCATGAAGAACCAGGTGGCAAGATTTAATGATCTGCGGTTTGTGGGCAGGAGTGGAAGA

Function

symbol description
runx2 Enables sequence-specific double-stranded DNA binding activity. Involved in osteoblast differentiation; positive regulation of osteoblast differentiation; and regulation of transcription, DNA-templated. Located in nucleoplasm. Implicated in cleidocranial dysplasia and metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome. Biomarker of esophagus squamous cell carcinoma.

NR:

description
frRunx2/p49

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0005524 ATP binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004140 True 435 mRNA 0.58 2 35207531 35210874

Neighbor

gene id symbol gene type direction distance location
AMCG00004139 NA coding upstream 34499 35172476 ~ 35173032 (+)
AMCG00004137 cdc5l,LOC107594083,LOC106599718 coding upstream 229898 34964466 ~ 34977633 (+)
AMCG00004128 NA coding upstream 373416 34820168 ~ 34834115 (+)
AMCG00004127 NA coding upstream 399109 34798389 ~ 34808422 (+)
AMCG00004126 klhl29,LOC107742703 coding upstream 482921 34695403 ~ 34724610 (+)
AMCG00004141 LOC107717234,LOC107594081,LOC107552040,LOC107653853 coding downstream 28358 35239232 ~ 35248925 (+)
AMCG00004149 NA coding downstream 146548 35357422 ~ 35359998 (+)
AMCG00004145 NA coding downstream 187506 35398380 ~ 35406953 (+)
AMCG00004150 NA coding downstream 240197 35451071 ~ 35455522 (+)
AMCG00004151 NA coding downstream 246280 35457154 ~ 35458783 (+)
G5867 NA non-coding upstream 311870 34894102 ~ 34895661 (+)
G5808 NA non-coding upstream 825432 34381868 ~ 34382099 (+)
G5804 NA non-coding upstream 915030 34292271 ~ 34292501 (+)
G5788 NA non-coding upstream 1117409 34081826 ~ 34090122 (+)
G5787 NA non-coding upstream 1126746 34078351 ~ 34080785 (+)
G5914 NA non-coding downstream 90229 35301103 ~ 35306949 (+)
G6002 NA non-coding downstream 244802 35455676 ~ 35455887 (+)
G6007 NA non-coding downstream 254988 35465862 ~ 35466655 (+)
G6067 NA non-coding downstream 609381 35820255 ~ 35820483 (+)
G6102 NA non-coding downstream 950732 36161606 ~ 36165870 (+)
AMCG00004138 fkbp1b other upstream 337211 34852863 ~ 34870320 (+)
G5642 NA other upstream 2076345 33130120 ~ 33131186 (+)
AMCG00004079 NA other upstream 2805148 32400405 ~ 32402383 (+)
AMCG00004056 ypel5,LOC107568027,LOC103458748,LOC102788175,LOC102210471 other upstream 4312704 30887995 ~ 30894827 (+)
AMCG00004039 NA other upstream 4900356 30296867 ~ 30307175 (+)
AMCG00004158 NA other downstream 541576 35752450 ~ 35766180 (+)
AMCG00004160 LOC106571404,LOC106607809,LOC105897019 other downstream 816405 36027279 ~ 36045282 (+)
AMCG00004167 NA other downstream 1050914 36261788 ~ 36278234 (+)
AMCG00004179 ptrhd1,LOC103399259 other downstream 1476756 36687630 ~ 36697885 (+)
G6314 NA other downstream 1563127 36774001 ~ 36774523 (+)

Expression


Co-expression Network