AMCG00004251 (disp1)


Basic Information

Item Value
gene id AMCG00004251
gene name disp1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 40059946 ~ 40083528 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004251
ATGATCATGCAGTACAGCCACGTCCTGGAGAGGTGTGTGGATGCAGTTCTGAGGGGGTCTGCCATTGTAGAGTCGGGAGCACATCTGCTTTTCCTCCAACGCTGCCTTCTCCACAGCGCCGCTGTCAGAGGCCAGAGGCTCGAGCTCATAGTGCTCGTGCTCCACCTCGGCCCCTCTAGCGTCCAGCTGATACTTACTCGTGTGGCACAACTTACTCTGGCTTCTGGTGGCAGGAGCTGTGGTGGACCCTTGGGAAAATGCCTGACACTGCAGTCTTTTGGGCAGGGGGATCTGCCCACAGGTGCCTTGGGGTCCCAGACATCTGCACATGCACTGGAAAAAGAAGGTGGCGAAAGCCCAGCTGATGCACATGATGAGCATCATGAAGGTGCCGAGCTGAGTGTAGGCCAGGACAGTGGAGGGCATCATCATGGCTCCAGCCACGAATGTTGTCAGGGCAGCCATTGCAATAGCGGAGCCCATGCGGCTCAGGGAGAAAACCACCTTGCCCTCTCGGTCTGGTTCGGGCGCAAGGCGGTAAGCCACTCCGTAATGAACAGCAAAGTCCACCGACAGTCCTACTGCAACAGAAATGGTGACTGA

Function

symbol description
disp1 Acts upstream of or within several processes, including animal organ development; muscle cell fate specification; and retinal ganglion cell axon guidance. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in mouth; neuroectoderm; oral region; pharyngeal endoderm; and pharynx. Orthologous to human DISP1 (dispatched RND transporter family member 1).

NR:

description
PREDICTED: protein dispatched homolog 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004251 True 603 mRNA 0.57 2 40059946 40083528

Neighbor

gene id symbol gene type direction distance location
AMCG00004248 NA coding upstream 5494 40037711 ~ 40054452 (+)
AMCG00004250 NA coding upstream 29838 40021629 ~ 40030108 (+)
AMCG00004249 NA coding upstream 47571 40010525 ~ 40012375 (+)
AMCG00004246 tmem151b coding upstream 167120 39885665 ~ 39892826 (+)
AMCG00004236 hsp90ab1,hsp90bb coding upstream 213247 39839368 ~ 39846699 (+)
AMCG00004254 aida coding downstream 101349 40184877 ~ 40194871 (+)
AMCG00004256 NA coding downstream 136996 40220524 ~ 40228831 (+)
AMCG00004255 NA coding downstream 152000 40235528 ~ 40248464 (+)
AMCG00004265 NA coding downstream 487432 40570960 ~ 40598834 (+)
AMCG00004264 NA coding downstream 522926 40606454 ~ 40618190 (+)
G6819 NA non-coding upstream 25623 40015267 ~ 40034323 (+)
G6807 NA non-coding upstream 114891 39944500 ~ 39945055 (+)
G6771 NA non-coding upstream 289248 39770465 ~ 39770698 (+)
G6769 NA non-coding upstream 291339 39768384 ~ 39768607 (+)
G6684 NA non-coding upstream 911652 39122547 ~ 39148294 (+)
G6840 NA non-coding downstream 5080 40088608 ~ 40088914 (+)
G6847 NA non-coding downstream 26672 40110200 ~ 40113951 (+)
G6850 NA non-coding downstream 65434 40148962 ~ 40198962 (+)
G7048 NA non-coding downstream 894471 40977999 ~ 40978319 (+)
G7078 LOC103376870 non-coding downstream 1211770 41295298 ~ 41364066 (+)
AMCG00004210 fam49a,znf395,LOC108440968,LOC106571599,LOC107696187,LOC107553485,LOC106608122 other upstream 2212226 37832623 ~ 37847720 (+)
G6369 NA other upstream 3059788 36999357 ~ 37000158 (+)
G6328 NA other upstream 3168200 36861547 ~ 36891746 (+)
G6314 NA other upstream 3285423 36774001 ~ 36774523 (+)
AMCG00004179 ptrhd1,LOC103399259 other upstream 3362061 36687630 ~ 36697885 (+)
AMCG00004257 dusp10,LOC106607590 other downstream 242882 40326410 ~ 40341235 (+)
G7094 NA other downstream 1376048 41459576 ~ 41507231 (+)
AMCG00004304 NA other downstream 2126902 42210430 ~ 42216362 (+)
G7329 fabp7,LOC108247051,LOC104945778 other downstream 2605251 42688779 ~ 42691109 (+)
AMCG00004355 hyou1,LOC100380749 other downstream 4534657 44618185 ~ 44640732 (+)

Expression


Co-expression Network