AMCG00004334 (slc35f1,LOC107697151,LOC107678858,LOC107743307,LOC107549682)


Basic Information

Item Value
gene id AMCG00004334
gene name slc35f1,LOC107697151,LOC107678858,LOC107743307,LOC107549682
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 43519979 ~ 43539410 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004334
ATGAGAGGAGAAGAAAATTTACTGGCAATATTGAAGAGAAGATGGTGGAAGTACATGATCCTGGGGTTAATAGATATAGAAGCCAATTACCTGGTAATCAAAGCATACCAGTACACCACACTTACAAGTGTGCAGCTTTTAGACTGTTTTGTTATCCCAGTGGTGCTATTGCTGTCCTGGTTCTTCTTGTTGGTGAGGTACAAGGCCGTTCACTTCATTGGCGTCGGAGTGTGCCTGCTGGGAATGGGCTGCATGGTGGGTGCTGATGTACTGGTTGGGAGACAGCAGGGCTTCGGAGATCACAAGCTCCTGGGAGACCTGTTGGTCCTGGCTGGAGCCACGCTGTACGGCATCTCCAACGTGTGCGAGGAGTTCATCGTGAAGAACCTCAGCCGGGTGGAGTTTCTGGGAATGATCGGCCTCTTTGGCTCTTTCTTCAGTGGTATACAACTGTAA

Function

symbol description
slc35f1 Predicted to enable transmembrane transporter activity. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human SLC35F1 (solute carrier family 35 member F1).

NR:

description
PREDICTED: solute carrier family 35 member F1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004334 True 456 mRNA 0.49 4 43519979 43539410

Neighbor

gene id symbol gene type direction distance location
AMCG00004337 slc35f1,LOC107727669,LOC107678858,LOC107743307,LOC107697151 coding downstream 5543 43485269 ~ 43514436 (-)
AMCG00004333 NA coding downstream 34730 43467169 ~ 43485249 (-)
AMCG00004325 NA coding downstream 484701 42975752 ~ 43035278 (-)
AMCG00004322 NA coding downstream 594180 42922676 ~ 42925799 (-)
AMCG00004324 NA coding downstream 599785 42914142 ~ 42920194 (-)
AMCG00004339 NA coding upstream 53743 43593153 ~ 43604125 (-)
AMCG00004341 NA coding upstream 66459 43605869 ~ 43608735 (-)
AMCG00004340 NA coding upstream 95737 43635147 ~ 43671248 (-)
AMCG00004344 NA coding upstream 186262 43725672 ~ 43734731 (-)
AMCG00004345 NA coding upstream 238739 43778149 ~ 43789688 (-)
G7419 NA non-coding downstream 282369 43235818 ~ 43237610 (-)
G7336 NA non-coding downstream 782129 42725912 ~ 42737850 (-)
G7335 NA non-coding downstream 800288 42692754 ~ 42719691 (-)
G7270 NA non-coding downstream 1206861 42312919 ~ 42313118 (-)
G7268 NA non-coding downstream 1255002 42264690 ~ 42264977 (-)
G7554 NA non-coding upstream 329053 43868463 ~ 43868706 (-)
G7580 NA non-coding upstream 543687 44083097 ~ 44089780 (-)
G7583 NA non-coding upstream 638236 44177646 ~ 44177988 (-)
G7585 NA non-coding upstream 796861 44336271 ~ 44336570 (-)
G7587 NA non-coding upstream 868950 44408360 ~ 44408665 (-)
AMCG00004336 NA other downstream 69724 43402953 ~ 43450255 (-)
AMCG00004313 NA other downstream 988973 42376726 ~ 42531006 (-)
AMCG00004302 NA other downstream 1452315 42064989 ~ 42067664 (-)
G6792 hs90b,hsp90bb,hsp90ab1 other downstream 3670856 39841935 ~ 39849123 (-)
G6441 NA other downstream 6151157 37367985 ~ 37368822 (-)
G7608 NA other upstream 981504 44520914 ~ 44522213 (-)
AMCG00004364 NA other upstream 1000753 44540163 ~ 44561575 (-)
AMCG00004372 LOC108423781,LOC105921217 other upstream 1083780 44623190 ~ 44712051 (-)
G7868 NA other upstream 2767516 46306926 ~ 46307319 (-)
G7882 LOC107575789 other upstream 2928715 46468125 ~ 46468434 (-)

Expression


Co-expression Network