AMCG00004519 (tomm40l,si:dkey-71l1.1,LOC103030645,LOC107691796,LOC107603199,LOC107574698,LOC107745123,LOC107663776)


Basic Information

Item Value
gene id AMCG00004519
gene name tomm40l,si:dkey-71l1.1,LOC103030645,LOC107691796,LOC107603199,LOC107574698,LOC107745123,LOC107663776
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 52227620 ~ 52232504 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004519
ATGGGCAGTGTCCTGGCCCTGTCCTCTCGCCCTGCTCGCCTGAACTCCCCGTTCCCGCAGGACCGGCCCCTCTCACGTTGGGACAGGAGAGAAGGGCGACTACCCAACCCGGGGGGCTTTGACGGCCTGCACCGGAGCTGCAAAGATGTCTTTCCACAGCAGACTGAAGGTGTCAAGCTGATCATCAACAAGACCATAAGCAGTTTCTTCAAGGTGAGCCACACCTTCCACCTCAGTGCCGTGGGGCCGTCGAACTACCGCTTCCACGCCTCCTACCTGCAGTCAGACACGGACAGCAAACAAGTGGACTCCCCCATCCTGATTGGGGAGATGGACTCTTCTGGCAGTTTGAACGCTCACTCTCTGCTACACCTGAGCGAGCGAATCCGAGCCAAAGCAGTCTTTCAGACCCAGCAGTCCCAGTTCGTCACCTGGCAGTTCGAGACTGAGTATCGGGGCAGCGACTTCACCGCCGCCTGCACCCTGGCGAACCCGGACGTCCTCAAGGAGTCAGTAATCATGGTCGCACACTTCCTCCAGAGTGTGTCACCGCAACTGGTGCTGGGAGGGGAACTGGTGTACCACCGGGGTCGGGCAGAGGAAGGGGGCATCCTCACGCTGGCGGGGCAGTACTCGGGTCCAAACTGGGTGGCGACTTTGAATGCTGGGAAAGGAGGGGCCCACGCCAGTTACTACCACAGAGCCAACAAACAGATCCAGGTGGGTGTGGAGTTTGAGGCCAGCACGAGGACTCGCGAGACCACCTTCTCCTTCGGCTACCGGTTGGACCTCCCCGAAGCCAACATGGTCTTCCGAGGGATGCTGGACAGCCGGTGCATCATCGGGGGCGTCCTGGAGAAGCGCCTCTCCCCTCTGCCCGCTGTCCTGACGCTGGGGGCGTTCGTCAACCACCGGGGGGACAAGGTGCAGTGCGGGCTGGGCGTCACCGTGGGCTAG

Function

symbol description
tomm40l Predicted to enable protein transmembrane transporter activity. Predicted to be involved in protein import into mitochondrial matrix. Predicted to act upstream of or within protein transport and transmembrane transport. Predicted to be located in mitochondrial outer membrane. Predicted to be integral component of membrane. Predicted to be part of mitochondrial outer membrane translocase complex. Is expressed in several structures, including head; immature eye; liver; midbrain; and pectoral fin bud. Human ortholog(s) of this gene implicated in cerebral infarction. Orthologous to human TOMM40 (translocase of outer mitochondrial membrane 40).
si:dkey-71l1.1 Predicted to enable protein transmembrane transporter activity. Predicted to act upstream of or within protein import into mitochondrial matrix. Predicted to be located in mitochondrial outer membrane. Predicted to be integral component of membrane.

NR:

description
mitochondrial import receptor subunit TOM40B-like

GO:

id name namespace
GO:0055085 transmembrane transport biological_process
GO:0005741 mitochondrial outer membrane cellular_component

KEGG:

id description
K11518 TOM40; mitochondrial import receptor subunit TOM40

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004519 True 957 mRNA 0.62 9 52227620 52232504

Neighbor

gene id symbol gene type direction distance location
AMCG00004517 NA coding downstream 5427 52212630 ~ 52222193 (-)
AMCG00004502 NA coding downstream 308721 51870043 ~ 51918899 (-)
AMCG00004503 NA coding downstream 359082 51856858 ~ 51868538 (-)
AMCG00004497 NA coding downstream 395281 51817211 ~ 51832339 (-)
AMCG00004493 NA coding downstream 700025 51520856 ~ 51527595 (-)
AMCG00004518 NA coding upstream 4710 52237214 ~ 52240865 (-)
AMCG00004521 grik4,LOC108439963,LOC108277597 coding upstream 22339 52254843 ~ 52296244 (-)
AMCG00004522 NA coding upstream 85127 52317631 ~ 52336606 (-)
AMCG00004523 grik4,LOC108439963,LOC107676315,LOC106529682 coding upstream 120868 52353372 ~ 52399171 (-)
AMCG00004524 NA coding upstream 390902 52623406 ~ 52665227 (-)
G8795 NA non-coding downstream 23940 52203194 ~ 52203680 (-)
G8776 NA non-coding downstream 59079 52168340 ~ 52168541 (-)
G8769 NA non-coding downstream 64538 52116880 ~ 52163082 (-)
G8765 NA non-coding downstream 136373 52090869 ~ 52091247 (-)
G8759 NA non-coding downstream 162170 52063404 ~ 52065450 (-)
G8829 NA non-coding upstream 136735 52369239 ~ 52369463 (-)
G8833 NA non-coding upstream 321415 52553919 ~ 52554373 (-)
G8981 NA non-coding upstream 869397 53101901 ~ 53104836 (-)
G9002 NA non-coding upstream 915261 53147765 ~ 53147974 (-)
G9048 NA non-coding upstream 1048547 53281051 ~ 53284971 (-)
G8761 NA other downstream 156034 52068053 ~ 52071586 (-)
G8760 NA other downstream 161738 52065526 ~ 52065882 (-)
AMCG00004505 NA other downstream 273088 51942693 ~ 51954532 (-)
AMCG00004481 NA other downstream 1489104 50730963 ~ 50738516 (-)
G8542 foxred1 other downstream 1502267 50723867 ~ 50725353 (-)
AMCG00004529 bco2 other upstream 617979 52850483 ~ 52874108 (-)
AMCG00004533 NA other upstream 666255 52898759 ~ 52911752 (-)
G8937 NA other upstream 714308 52946812 ~ 52951387 (-)
AMCG00004551 NA other upstream 946518 53179022 ~ 53189393 (-)
AMCG00004567 NA other upstream 1453912 53686416 ~ 53863369 (-)

Expression


Co-expression Network