G122



Basic Information


Item Value
gene id G122
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 734766 ~ 769986 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU150
ttttaacagtgagagacagaataacaacaaaaaaatccagaaaaactaatttcaaaaaagttataaattgatttgcatgttaatgagggaaataagtatttgatcccctatcaatcagcaagatttctggctcccaggtgtcttttatacaggtaatgagctgagattaggagcactctcttaaagggagtgacacctgtccacagaagcaatcaatcaatc

Function


GO:

id name namespace
GO:0006091 generation of precursor metabolites and energy biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU150 True 222 lncRNA 0.36 3 734766 769986

Neighbor


gene id symbol gene type direction distance location
AMCG00003394 NA coding downstream 70490 660528 ~ 664276 (-)
AMCG00003393 NA coding downstream 107076 619566 ~ 627690 (-)
AMCG00003392 NA coding downstream 137588 594275 ~ 597178 (-)
AMCG00003391 gpr63,LOC106571327,LOC106607724 coding downstream 195025 538794 ~ 539741 (-)
AMCG00003390 NA coding downstream 494253 232621 ~ 240513 (-)
AMCG00003401 NA coding upstream 149326 919312 ~ 930578 (-)
AMCG00003402 NA coding upstream 298053 1068039 ~ 1216767 (-)
AMCG00003403 NA coding upstream 474568 1244554 ~ 1246054 (-)
AMCG00003404 NA coding upstream 483883 1253869 ~ 1254981 (-)
AMCG00003407 nmbr,LOC106607916,LOC106571412 coding upstream 886399 1656385 ~ 1724582 (-)
G112 NA non-coding downstream 118446 614191 ~ 616320 (-)
G103 NA non-coding downstream 176032 519101 ~ 558734 (-)
G89 NA non-coding downstream 248866 485584 ~ 485900 (-)
G188 NA non-coding upstream 263674 1033660 ~ 1035682 (-)
G212 NA non-coding upstream 372252 1142238 ~ 1158563 (-)
G257 NA non-coding upstream 817831 1587817 ~ 1588261 (-)
G263 NA non-coding upstream 944591 1714577 ~ 1714856 (-)
G277 NA non-coding upstream 1056511 1826497 ~ 1830075 (-)
AMCG00003400 abracl,LOC107727609,LOC107558932,LOC107553474 other upstream 175237 945223 ~ 957196 (-)
AMCG00003423 NA other upstream 1627656 2397642 ~ 2401895 (-)
AMCG00003422 NA other upstream 1657411 2427397 ~ 2438821 (-)
G531 adck3,coq8a,LOC107602173,LOC107675039,LOC107727627 other upstream 2624671 3394657 ~ 3430272 (-)
AMCG00003444 NA other upstream 2766186 3536172 ~ 3538967 (-)

Expression



Co-expression Network