G2291 (xdh,LOC107752765,LOC107592779,LOC107733164,LOC107674096)


Basic Information

Item Value
gene id G2291
gene name xdh,LOC107752765,LOC107592779,LOC107733164,LOC107674096
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 13233495 ~ 13236993 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU2776
ACCCTTTTGACTTATCTAAGAAGAAAATTGGGCCTGACAGGAACCAAGCTGGGCTGTGCTGAGGGAGGGTGCGGCGCTTGCACAGTGATGGTCTCCACGTTCCATCCCCATATGAACAAGATCATTCACTACTCTGTAAACGCCTGCCTGGCTCCAATTTGTTCCCTGCACCACTGCGCTGTCACCACTGTGGAGGGGATTGGCAGCGTCACCACCAAGCTGCATCCTGTTCAGG

Function

symbol description
xdh Predicted to enable xanthine dehydrogenase activity. Predicted to be involved in xanthine catabolic process. Predicted to be located in peroxisome. Predicted to be active in extracellular space. Is expressed in neural crest cell and xanthoblast. Human ortholog(s) of this gene implicated in several diseases, including Lesch-Nyhan syndrome; cardiovascular system disease (multiple); chronic kidney disease; hyperuricemia; and xanthinuria. Orthologous to human XDH (xanthine dehydrogenase).

NR:

description
PREDICTED: xanthine dehydrogenase/oxidase-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2776 True 235 lncRNA 0.54 3 13233495 13236993

Neighbor

gene id symbol gene type direction distance location
AMCG00003662 xdh,LOC104966294 coding downstream 21315 13117366 ~ 13212180 (-)
AMCG00003651 lin9,LOC107678835,LOC107726751,LOC107697095 coding downstream 167941 13055994 ~ 13065554 (-)
AMCG00003650 acbd3,LOC106571761 coding downstream 183103 13037692 ~ 13050392 (-)
AMCG00003645 NA coding downstream 265339 12926695 ~ 12968156 (-)
AMCG00003646 NA coding downstream 326606 12905372 ~ 12906889 (-)
AMCG00003658 wdr26,LOC103044372 coding upstream 14105 13251098 ~ 13270245 (-)
AMCG00003657 NA coding upstream 44458 13281451 ~ 13283514 (-)
AMCG00003659 adcy3,LOC107688975 coding upstream 53306 13290299 ~ 13316898 (-)
AMCG00003663 NA coding upstream 150814 13387807 ~ 13398847 (-)
AMCG00003664 tgfb2 coding upstream 272798 13509791 ~ 13514900 (-)
G2287 NA non-coding downstream 55323 13172632 ~ 13178172 (-)
G2285 NA non-coding downstream 89967 13131620 ~ 13143528 (-)
G2266 NA non-coding downstream 132177 13100512 ~ 13101318 (-)
G2257 NA non-coding downstream 153474 13077648 ~ 13080021 (-)
G2235 NA non-coding downstream 199435 13033239 ~ 13034060 (-)
G2324 NA non-coding upstream 177868 13414861 ~ 13415156 (-)
G2337 NA non-coding upstream 270899 13507892 ~ 13508930 (-)
G2443 fzd3b,LOC107729283,LOC107734193,LOC107665105,LOC107589599,LOC108270052 non-coding upstream 1172243 14409236 ~ 14410253 (-)
G2444 LOC108270052,LOC108428681 non-coding upstream 1178386 14415379 ~ 14415673 (-)
G2445 NA non-coding upstream 1181585 14418578 ~ 14419732 (-)
AMCG00003652 parp1,xdh,LOC102777090,LOC107603072,LOC104966294 other downstream 116835 13071796 ~ 13116660 (-)
G2236 NA other downstream 198006 13034953 ~ 13035489 (-)
AMCG00003625 NA other downstream 1155343 12075319 ~ 12078152 (-)
AMCG00003623 LOC101472980,LOC105894864,LOC108427479,LOC105908251,LOC106571292,LOC105017864 other downstream 1293712 11921991 ~ 11939783 (-)
AMCG00003618 NA other downstream 1444220 11743989 ~ 11789275 (-)
AMCG00003667 NA other upstream 427750 13664743 ~ 13732039 (-)
G2373 esrrg other upstream 772465 14009458 ~ 14013021 (-)
G2500 NA other upstream 1573793 14810786 ~ 14811331 (-)
G2665 crim1,LOC107679775,LOC107730201,LOC107602268,LOC107662656,LOC106601300 other upstream 2278680 15515673 ~ 15591730 (-)
AMCG00003734 NA other upstream 3370417 16607410 ~ 16628401 (-)

Expression


Co-expression Network