G2832


Basic Information

Item Value
gene id G2832
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 16586062 ~ 16586266 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU3452
GCACGTTCAGCTCTTTCAGACGTCCCTCTGCTGCGGTGCGGTCAGCCATGTTTGCGGAGAATGGAGATCGATAGTGCGATGATCATCTAGTCTGCCTGCTCTACGCGCTGTTTCGGAGTCGGTGTGAAAAGTCAAACAGAACTGCGAGCTGTAGAGAGGACTGCGCATGCGCAGCGACAACTGCAACTGTGAAAACGAGATTGAA

Function

GO: NA

KEGG:

id description
ko00260 Glycine, serine and threonine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU3452 True 205 lncRNA 0.45 1 16586062 16586266

Neighbor

gene id symbol gene type direction distance location
AMCG00003732 NA coding downstream 9475 16570530 ~ 16576587 (-)
AMCG00003731 NA coding downstream 42541 16535239 ~ 16543521 (-)
AMCG00003728 NA coding downstream 143536 16429027 ~ 16442526 (-)
AMCG00003725 gpn1,LOC107725955,LOC107729295,LOC107682285 coding downstream 266629 16308233 ~ 16319433 (-)
AMCG00003726 stmn4 coding downstream 285670 16292357 ~ 16300392 (-)
AMCG00003736 sccpdh,LOC105911215 coding upstream 7170 16593436 ~ 16597326 (-)
AMCG00003735 NA coding upstream 58094 16644360 ~ 16651502 (-)
AMCG00003741 NA coding upstream 293770 16880036 ~ 16881122 (-)
AMCG00003740 kif26b,kif26ba,LOC107682227,LOC107693166 coding upstream 297706 16883972 ~ 16892879 (-)
AMCG00003747 kif26b,LOC102197193,LOC107097817 coding upstream 406853 16993119 ~ 16994022 (-)
G2765 NA non-coding downstream 335579 16247935 ~ 16250483 (-)
G2722 NA non-coding downstream 500067 16085115 ~ 16085995 (-)
G2720 NA non-coding downstream 501196 16079399 ~ 16084866 (-)
G2699 NA non-coding downstream 553140 16032687 ~ 16032922 (-)
G2697 NA non-coding downstream 555876 16029424 ~ 16030186 (-)
G2834 NA non-coding upstream 1803 16588069 ~ 16588293 (-)
G2903 NA non-coding upstream 410524 16996790 ~ 16997604 (-)
G2902 NA non-coding upstream 455171 17041437 ~ 17042549 (-)
G2973 NA non-coding upstream 668005 17254271 ~ 17254765 (-)
G2972 NA non-coding upstream 671671 17257937 ~ 17259543 (-)
G2665 crim1,LOC107679775,LOC107730201,LOC107602268,LOC107662656,LOC106601300 other downstream 994332 15515673 ~ 15591730 (-)
G2500 NA other downstream 1774731 14810786 ~ 14811331 (-)
G2373 esrrg other downstream 2573041 14009458 ~ 14013021 (-)
AMCG00003667 NA other downstream 2854023 13664743 ~ 13732039 (-)
AMCG00003652 parp1,xdh,LOC102777090,LOC107603072,LOC104966294 other downstream 3469402 13071796 ~ 13116660 (-)
AMCG00003734 NA other upstream 21144 16607410 ~ 16628401 (-)
AMCG00003742 kif26ba,LOC107693166,LOC107682227,LOC107589674,LOC107586651,LOC107729288 other upstream 282066 16868332 ~ 16871475 (-)
AMCG00003751 NA other upstream 550982 17137248 ~ 17140382 (-)
G3181 NA other upstream 1356311 17942577 ~ 17944942 (-)
AMCG00003784 NA other upstream 1549113 18135379 ~ 18142681 (-)

Expression


Co-expression Network