G458


Basic Information

Item Value
gene id G458
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 3006968 ~ 3058204 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU557
aatcatttcaaattggtttcttgaacatgacaatgagttcactgtactaaaatggcccccacagtcaccagatctcaacccaatagagcatctttgggatgtggtggaacgggagcttcgtgccctggatgtgcatcccacaaatctccatcaactgcaagatgctatcctatcaatatgggccaacatttctaaagaatgctttcagcaccttgttgaatcaatgccacgtagaattaaggcagttctgaaggcaaaagggggtcaaacacagtgttcctaataatcctttaggtgagtgtatat

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0006821 chloride transport biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU557 True 306 lncRNA 0.53 2 3006968 3058204

Neighbor

gene id symbol gene type direction distance location
AMCG00003431 galnt14,LOC106607829,LOC106571428,LOC108429358,LOC107676246 coding downstream 281049 2674158 ~ 2725919 (-)
AMCG00003426 NA coding downstream 483643 2507558 ~ 2523325 (-)
AMCG00003424 NA coding downstream 591017 2408054 ~ 2415951 (-)
AMCG00003418 NA coding downstream 669908 2330695 ~ 2337060 (-)
AMCG00003417 NA coding downstream 703555 2295450 ~ 2303413 (-)
AMCG00003435 NA coding upstream 155607 3213811 ~ 3217086 (-)
AMCG00003437 NA coding upstream 181680 3239884 ~ 3250722 (-)
AMCG00003436 NA coding upstream 231833 3290037 ~ 3291227 (-)
AMCG00003440 NA coding upstream 340522 3398726 ~ 3400684 (-)
AMCG00003439 NA coding upstream 346766 3404970 ~ 3415285 (-)
G453 NA non-coding downstream 1287 3005372 ~ 3005681 (-)
G372 NA non-coding downstream 600884 2405643 ~ 2406084 (-)
G345 LOC107575789 non-coding downstream 659559 2347062 ~ 2347409 (-)
G322 NA non-coding downstream 920210 2086458 ~ 2086758 (-)
G306 NA non-coding downstream 979618 2026921 ~ 2027350 (-)
G464 NA non-coding upstream 28261 3086465 ~ 3111051 (-)
G500 NA non-coding upstream 137701 3195905 ~ 3211877 (-)
G541 ccdc25 non-coding upstream 365884 3424088 ~ 3428291 (-)
G578 NA non-coding upstream 465820 3524024 ~ 3525095 (-)
G586 mtmr9 non-coding upstream 538717 3596921 ~ 3599589 (-)
AMCG00003422 NA other downstream 568147 2427397 ~ 2438821 (-)
AMCG00003423 NA other downstream 605073 2397642 ~ 2401895 (-)
AMCG00003400 abracl,LOC107727609,LOC107558932,LOC107553474 other downstream 2049772 945223 ~ 957196 (-)
G531 adck3,coq8a,LOC107602173,LOC107675039,LOC107727627 other upstream 336453 3394657 ~ 3430272 (-)
AMCG00003444 NA other upstream 477968 3536172 ~ 3538967 (-)
AMCG00003459 NA other upstream 818028 3876232 ~ 3895524 (-)
AMCG00003476 NA other upstream 1524938 4583142 ~ 4808989 (-)
AMCG00003484 NA other upstream 2285866 5344070 ~ 5356468 (-)

Expression


Co-expression Network