G464



Basic Information


Item Value
gene id G464
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 3086465 ~ 3111051 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU568
attttaacagtgagagacagaataacaacaaaaggcaacaaaggagtggctcaagaagaagcacattaaggtcctggagtggcctagccagtctccagaccttaatcccatagaaaatctgtggagggagctgaaggttcgagttgccaaacgtcagcctcgaaaccttaatgacttggagaggatctgcaaagaggagtgggaaaaaatccctcctgagatgtgtgcaaacctggtggccaactacaagaaacgtttgacctctgtgattgccaacaagggttttgccaccaagtactaagtcgaaggggtcaaac

Function


NR:

description
unnamed protein product

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU568 True 317 lncRNA 0.37 2 3086465 3111051

Neighbor


gene id symbol gene type direction distance location
AMCG00003431 galnt14,LOC106607829,LOC106571428,LOC108429358,LOC107676246 coding downstream 360546 2674158 ~ 2725919 (-)
AMCG00003426 NA coding downstream 563140 2507558 ~ 2523325 (-)
AMCG00003424 NA coding downstream 670514 2408054 ~ 2415951 (-)
AMCG00003418 NA coding downstream 749405 2330695 ~ 2337060 (-)
AMCG00003417 NA coding downstream 783052 2295450 ~ 2303413 (-)
AMCG00003435 NA coding upstream 102760 3213811 ~ 3217086 (-)
AMCG00003437 NA coding upstream 128833 3239884 ~ 3250722 (-)
AMCG00003436 NA coding upstream 178986 3290037 ~ 3291227 (-)
AMCG00003440 NA coding upstream 287675 3398726 ~ 3400684 (-)
AMCG00003439 NA coding upstream 293919 3404970 ~ 3415285 (-)
G458 NA non-coding downstream 28261 3006968 ~ 3058204 (-)
G453 NA non-coding downstream 80784 3005372 ~ 3005681 (-)
G372 NA non-coding downstream 680381 2405643 ~ 2406084 (-)
G345 LOC107575789 non-coding downstream 739056 2347062 ~ 2347409 (-)
G322 NA non-coding downstream 999707 2086458 ~ 2086758 (-)
G500 NA non-coding upstream 84854 3195905 ~ 3211877 (-)
G541 ccdc25 non-coding upstream 313037 3424088 ~ 3428291 (-)
G578 NA non-coding upstream 412973 3524024 ~ 3525095 (-)
G586 mtmr9 non-coding upstream 485870 3596921 ~ 3599589 (-)
G624 NA non-coding upstream 751946 3862997 ~ 3865429 (-)
AMCG00003422 NA other downstream 647644 2427397 ~ 2438821 (-)
AMCG00003423 NA other downstream 684570 2397642 ~ 2401895 (-)
AMCG00003400 abracl,LOC107727609,LOC107558932,LOC107553474 other downstream 2129269 945223 ~ 957196 (-)
G531 adck3,coq8a,LOC107602173,LOC107675039,LOC107727627 other upstream 283606 3394657 ~ 3430272 (-)
AMCG00003444 NA other upstream 425121 3536172 ~ 3538967 (-)
AMCG00003459 NA other upstream 765181 3876232 ~ 3895524 (-)
AMCG00003476 NA other upstream 1472091 4583142 ~ 4808989 (-)
AMCG00003484 NA other upstream 2233019 5344070 ~ 5356468 (-)

Expression



Co-expression Network