AMCG00004778 (agbl4)


Basic Information

Item Value
gene id AMCG00004778
gene name agbl4
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 1561785 ~ 1606266 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004778
GTGTCATTGACTTCCTGCTCAGCCAGAACCCAGTGGCCAAAGTCCTGAGAGATCACGTGGTCTTCAAGATTGTCCCCATGCTCAATCCTGACGGAGTCTACCTGGGCAACTATCGGTGTTCTCTGATGGGCTTTGACCTGAACCGCCACTGGCAGGACCCCTCTCCGTGGGCTCACCCCACACTGCATGCTGTGAAACAGCTCATTATCCAGATGAACGAGGACCCGAGGGTGAGTCTGGAGTTCTACATTGATATCCATGCACACTCCACCATGATGAATGGCTTCATGTATGGCAATGTGTTTGAGGAGGAGGACCGTGTCCAGAGGCAGGCCGTCTTTCCCAGGCTTCTGTGTCACAATGCCCCAGACTTCTCCTTTTCCAGCACATCCTTCAACCGAGATGTGGTGAAGGCCGGGACAGGACGACGCTTCCTGGGTGGCCTTCTAGATGACTCATCTTATTCCTACACTCTGGAGGTGTCCTTCTACAGCTACATGGTGACCGGCAGCACTCTACCAGTTCCCTACACTGAAGACGCCTGTATCCTTTCTGGTTACGTAGACATTTTGTTGAGTAATGGCGTTGGCGTTGGCTCGCGGACTGGAGCAGCCAGGACCGGGACCTCTGGCAAGTCGGTGGAGGCCAGGACCGGGACTGGGACCTCTGGCAAGGCGGCGGCCAGAACCGGCCTGGGTGGA

Function

symbol description
agbl4 Is expressed in Kupffer's vesicle; eye; otic vesicle; peripheral olfactory organ; and pronephros. Orthologous to human AGBL4 (AGBL carboxypeptidase 4).

NR:

description
PREDICTED: cytosolic carboxypeptidase 6

GO: NA

KEGG:

id description
K23439 AGBL4, CCP6; cytosolic carboxypeptidase protein 6

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004778 True 701 mRNA 0.56 5 1561785 1606266

Neighbor

gene id symbol gene type direction distance location
AMCG00004779 NA coding downstream 41299 1519517 ~ 1520486 (-)
AMCG00004773 NA coding downstream 333202 1228125 ~ 1228583 (-)
AMCG00004768 cacna1e,LOC107665051,LOC107549680,LOC107599003 coding downstream 384163 1177341 ~ 1177622 (-)
AMCG00004771 LOC107700326,LOC107562853,LOC107671548,LOC106613910,LOC108436878 coding downstream 411495 1142360 ~ 1150290 (-)
AMCG00004772 NA coding downstream 453268 1074450 ~ 1108517 (-)
AMCG00004777 bend5,LOC106584333 coding upstream 84762 1691028 ~ 1718262 (-)
AMCG00004780 LOC100286605,LOC106613892,LOC103464064 coding upstream 290014 1896280 ~ 1912141 (-)
AMCG00004781 NA coding upstream 594945 2201211 ~ 2204495 (-)
AMCG00004785 dmrta2,LOC106613895,LOC106584330 coding upstream 1082980 2689246 ~ 2691272 (-)
AMCG00004787 faf1,LOC102783815 coding upstream 1087759 2694025 ~ 2993047 (-)
G142990 NA non-coding downstream 33975 1527578 ~ 1527810 (-)
G142972 NA non-coding downstream 175098 1386423 ~ 1386687 (-)
G142967 NA non-coding downstream 180906 1379880 ~ 1380879 (-)
G142959 NA non-coding downstream 271800 1289664 ~ 1289985 (-)
G142953 NA non-coding downstream 391269 1170013 ~ 1170516 (-)
G143046 NA non-coding upstream 288822 1895088 ~ 1924283 (-)
G143062 NA non-coding upstream 683313 2289579 ~ 2290140 (-)
G143095 elavl4,LOC107657884,LOC106613894 non-coding upstream 950588 2556854 ~ 2561991 (-)
G143105 NA non-coding upstream 1034312 2640578 ~ 2640860 (-)
G143142 NA non-coding upstream 1075054 2681320 ~ 2681561 (-)
AMCG00004763 LOC107393006 other downstream 915174 644004 ~ 646611 (-)
G142773 NA other downstream 1431082 127778 ~ 130703 (-)
G142770 NA other downstream 1439258 119695 ~ 122527 (-)
G143145 NA other upstream 1103288 2709554 ~ 2710004 (-)
AMCG00004790 ttc39a,LOC107743871,LOC107548186,LOC107699571 other upstream 1513963 3120229 ~ 3217229 (-)
AMCG00004819 zbtb37,LOC106613586 other upstream 2502816 4109082 ~ 4116414 (-)
G143659 NA other upstream 4130543 5736809 ~ 5783184 (-)
G144050 selenof,LOC106598901 other upstream 6747723 8353989 ~ 8377001 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000010_05359191_05385419 NA coding CI01000010 null 5359191 ~ 5385684 (+)