AMCG00004782 (elavl4,LOC106613894)


Basic Information

Item Value
gene id AMCG00004782
gene name elavl4,LOC106613894
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 2490454 ~ 2490690 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004782
ATGGACCCTCAGGTGACGAATGGGCCGAGCGCCACTACGGCTAACGGGCCTTCCAGTAACAGTCGGAGCTGCCCCTCCCCTATGCAGACTGGCAGTGTCACTGACGACAGCAAGACCAACCTCATTGTCAACTACCTGCCCCAGAACATGACCCAAGAGGAGTTCCGCAGTCTGTTCGGCAGCATCGGAGAGATCGAATCCTGCAAGCTGGTCCGAGACAAGATCACAGGTAAATAA

Function

symbol description
elavl4 Predicted to enable RNA binding activity. Acts upstream of or within axonogenesis. Part of protein-containing complex. Is expressed in nervous system and trigeminal placode. Orthologous to human ELAVL4 (ELAV like RNA binding protein 4).

NR:

description
PREDICTED: ELAV-like protein 4 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004782 True 237 mRNA 0.56 1 2490454 2490690

Neighbor

gene id symbol gene type direction distance location
AMCG00004775 NA coding upstream 1033204 1435263 ~ 1457250 (+)
AMCG00004776 NA coding upstream 1058644 1429518 ~ 1431810 (+)
AMCG00004774 NA coding upstream 1083207 1406999 ~ 1407247 (+)
AMCG00004758 NA coding upstream 1830665 650702 ~ 659789 (+)
AMCG00004757 LOC107707585,LOC107599011,LOC107657879 coding upstream 1933173 539775 ~ 557281 (+)
AMCG00004783 elavl4,LOC107657884,LOC106613894 coding downstream 57917 2548607 ~ 2558673 (+)
AMCG00004784 NA coding downstream 461621 2952311 ~ 2952624 (+)
AMCG00004786 NA coding downstream 507316 2998006 ~ 3002925 (+)
AMCG00004791 calr,LOC102308154,LOC102192544,LOC101484884,LOC107393148,LOC106512241,LOC100701980 coding downstream 761280 3251970 ~ 3262480 (+)
AMCG00004792 NA coding downstream 811813 3302503 ~ 3307925 (+)
G143029 NA non-coding upstream 181580 2259729 ~ 2308874 (+)
G142973 NA non-coding upstream 1078247 1411957 ~ 1412207 (+)
G142958 NA non-coding upstream 1200469 1289709 ~ 1289985 (+)
G142910 NA non-coding upstream 1697511 789038 ~ 792943 (+)
G142881 rpe65,LOC107708597,LOC107657893 non-coding upstream 1788696 667957 ~ 701758 (+)
G143074 NA non-coding downstream 68627 2559317 ~ 2562389 (+)
G143107 NA non-coding downstream 190614 2681304 ~ 2681548 (+)
G143109 LOC103376870 non-coding downstream 229608 2720298 ~ 2761630 (+)
G143166 NA non-coding downstream 593682 3084372 ~ 3086394 (+)
G143170 NA non-coding downstream 608432 3099122 ~ 3099384 (+)
AMCG00004749 NA other upstream 2367489 116491 ~ 122965 (+)
AMCG00004788 NA other downstream 632391 3123081 ~ 3160209 (+)
AMCG00004793 NA other downstream 887125 3377815 ~ 3395158 (+)
G143366 NA other downstream 1458736 3949426 ~ 3949837 (+)
G143404 LOC107757485,LOC107715094,LOC107588062,LOC107653629,LOC106613586,LOC107592717,LOC107669813 other downstream 1618332 4109022 ~ 4109655 (+)
G143471 LOC107575789 other downstream 1881019 4371709 ~ 4372089 (+)

Expression


Co-expression Network