AMCG00004830 (nfia)


Basic Information

Item Value
gene id AMCG00004830
gene name nfia
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 4677473 ~ 4686323 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004830
ATGGCTTGGATCCAGTCAGCGAGTCCACACGCTACGCCGTCAACTCTCCATTTCCCGACGTCGCCAATCATTCAGCAACCCGGCCCCTACTTCTCCCACCCAGCCATCCGTTACCACCCCCAGGAGACCCTGAAGGAGTTTGTCCAACTTGTCTGCCCTGACAGTGGTCAGCAAGCTGGACAGCCCAATGGGAGCAGCCAAGGCAAGGTGCACAACCCATTCCTTCCCACGCCCATGTTGCCACCACCGCCCCCACCGCCAATGGCCAGGCCTGTGCCCTTGCCAGTGCCAGACTCCAAACCCCCCTCGACGTCGACCGAAGGAGGAGGCAATTCCCCCACATCTCCCACCTACTCTACGCCCAGCACCTCCCCCGCCCAGCGATTTGTGAGCGTCGGGCCCCGAGACCCCAGCTTTGTAAATATCCCTCAACAGCCACAGGTGGGTGCTTTCTACCTTACTGTACTGCCCTGGTTACCCTTCTATTCCATTGCTGCTGCATTTTGCTGCTACTTGGACAGGTTACACCATGGGAAGAGATTCAGTAGTGATTTCTGTGGAGCTGGCCTGGCCGAGGCCAGCCGTCTTAAATCATCCCCCAACTGCCCTGGGTCTCCGTCATCGTAG

Function

symbol description
nfia Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within DNA replication and regulation of transcription, DNA-templated. Predicted to be active in nucleus. Is expressed in brain. Human ortholog(s) of this gene implicated in NFIA-related disorder. Orthologous to human NFIA (nuclear factor I A).

NR:

description
PREDICTED: nuclear factor 1 A-type isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004830 True 627 mRNA 0.59 5 4677473 4686323

Neighbor

gene id symbol gene type direction distance location
AMCG00004828 NA coding downstream 86043 4576416 ~ 4591430 (-)
AMCG00004829 patj,inadl coding downstream 194693 4439540 ~ 4482780 (-)
AMCG00004824 NA coding downstream 317537 4324963 ~ 4359936 (-)
AMCG00004823 NA coding downstream 459480 4201008 ~ 4217993 (-)
AMCG00004820 NA coding downstream 527472 4133709 ~ 4150001 (-)
AMCG00004831 NA coding upstream 20769 4707092 ~ 4726469 (-)
AMCG00004832 nfia,LOC102782039 coding upstream 146078 4832401 ~ 4834300 (-)
AMCG00004836 rabgap1l,LOC106574055,LOC106613570,LOC105011404 coding upstream 382932 5069255 ~ 5094212 (-)
AMCG00004835 rabgap1l,LOC107715121,LOC106613570,LOC106574055 coding upstream 468275 5154598 ~ 5158802 (-)
AMCG00004837 gpr52,LOC107599442,LOC107715120,LOC107655251,LOC107592687,LOC107728559,LOC107669811 coding upstream 528005 5214328 ~ 5215407 (-)
G143430 NA non-coding downstream 486192 4187958 ~ 4191281 (-)
G143406 NA non-coding downstream 568617 4107519 ~ 4108856 (-)
G143400 serpinc1,LOC102797582 non-coding downstream 579057 4094650 ~ 4098416 (-)
G143396 NA non-coding downstream 588480 4085446 ~ 4088993 (-)
G143372 NA non-coding downstream 704928 3972316 ~ 3972545 (-)
G143528 NA non-coding upstream 105367 4791690 ~ 4858146 (-)
G143539 NA non-coding upstream 299065 4985388 ~ 4985694 (-)
G143544 NA non-coding upstream 330524 5016847 ~ 5017631 (-)
G143619 NA non-coding upstream 641392 5327715 ~ 5402341 (-)
G143759 NA non-coding upstream 1901828 6588151 ~ 6588746 (-)
AMCG00004819 zbtb37,LOC106613586 other downstream 561059 4109082 ~ 4116414 (-)
AMCG00004790 ttc39a,LOC107743871,LOC107548186,LOC107699571 other downstream 1460244 3120229 ~ 3217229 (-)
G143145 NA other downstream 1967469 2709554 ~ 2710004 (-)
AMCG00004763 LOC107393006 other downstream 4030862 644004 ~ 646611 (-)
G142773 NA other downstream 4546770 127778 ~ 130703 (-)
G143659 NA other upstream 1050486 5736809 ~ 5783184 (-)
G144050 selenof,LOC106598901 other upstream 3667666 8353989 ~ 8377001 (-)
AMCG00004894 kat3,kyat3,ccbl2,LOC100332215 other upstream 4150037 8836360 ~ 8847775 (-)
G144115 LOC108413222,LOC107749977,LOC107730703,LOC107698886,LOC107675437,LOC107564626 other upstream 4186562 8872885 ~ 8906594 (-)
AMCG00005011 best4,LOC103396708 other upstream 7449055 12135378 ~ 12156378 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000030_01699341_01705561 NA coding CI01000030 null 1699341 ~ 1705719 (-)