AMCG00004929 (diras2,LOC107560410,LOC107736992,LOC107670053,LOC107702570)


Basic Information

Item Value
gene id AMCG00004929
gene name diras2,LOC107560410,LOC107736992,LOC107670053,LOC107702570
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 9685517 ~ 9688791 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004929
GTTTTTTTTGCAGCAAAGCCAATGTCATACAGGCTCAATTGGACAGGTCGCCCTTATCACTGCCCCTCCACTCGCCCCCACACACGTATTCGTGATGCACAGCCAGCAGTCTCGACAGGACAGACTATGGGTCTGGGAAACAGCTTCGCAGCAGCAAATCAACAAGAGGAAGAATCCAAGAGGTTCAAGAAAGACAGAGCGTCAGACAGACCGAGAGAAAATGCCAGAGCAAAGTAATGACTACAGGGTGGTAGTGTTTGGAGCCGCTGGGGTGGGGAAAAGTTCCTTGGTACTGCGCTTCGTCCGGGGCACCTTTCGAGAGACCTACATCCCCACGATAGAAGACACCTACAGGCAGGTGATCAGCTGCGACAAGAACATCTGCACCCTGCAGATCACAGACACCACGGGCAGCCACCAGTTCCCGGCCATGCAGCGCCTCTCCATCTCCAAGGGCCACGCCTTCATCCTGGTCTATGCCGTCACCAGCAAGCAGTCCGTGGAGGAGCTGCAGCCCATCTACGAGCAGATCTGCCACATCAAAGGAGACGTCCAGAATATCCCCATCATGCTCGTGGGCAACAAAAGTGATGAGACGCAGAGAGAGGTGGAGGCTAGTGAGGGGGAGGGCCTGGCCACCAGGTGGAAGTGCTCTTTCATGGAGACCTCGGCCAAAATGAACTATAACGTGCAGGAGCTCTTCCAGGAACTTCTGAACCTGGAAAAAAGGCGGGCGGTCAGCCTGCAGGTGGACGGGAAGAAGTCCAAGCAGCTGAAGAAGAAAGACCGTCTGAAAGGGAAATGCTCCATCATGTAG

Function

symbol description
diras2 Enables GTP binding activity. Predicted to be involved in signal transduction. Located in plasma membrane.

NR:

description
GTP-binding protein Di-Ras2

GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:0016020 membrane cellular_component
GO:0005525 GTP binding molecular_function

KEGG:

id description
K07841 DIRAS2; DIRAS family, GTP-binding Ras-like 2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004929 True 817 mRNA 0.55 2 9685517 9688791

Neighbor

gene id symbol gene type direction distance location
AMCG00004924 wls coding upstream 1394 9663323 ~ 9684123 (+)
AMCG00004923 dr1,nc2b coding upstream 27514 9653584 ~ 9658003 (+)
AMCG00004928 LOC103368644,LOC107091536,LOC106920129,LOC103463988,LOC103139842 coding upstream 34454 9647466 ~ 9651063 (+)
AMCG00004927 NA coding upstream 39105 9632837 ~ 9646412 (+)
AMCG00004925 NA coding upstream 66728 9594021 ~ 9618789 (+)
AMCG00004930 NA coding downstream 74728 9763519 ~ 9779724 (+)
AMCG00004932 NA coding downstream 159793 9848584 ~ 9888182 (+)
AMCG00004936 NA coding downstream 249630 9938421 ~ 9941239 (+)
AMCG00004934 NA coding downstream 361267 10050058 ~ 10116505 (+)
AMCG00004945 ptprf coding downstream 916856 10605647 ~ 10607897 (+)
G144237 NA non-coding upstream 128042 9554100 ~ 9557475 (+)
G144227 NA non-coding upstream 184539 9494496 ~ 9500978 (+)
G144218 NA non-coding upstream 218904 9464141 ~ 9466613 (+)
G144210 NA non-coding upstream 236984 9447589 ~ 9448533 (+)
G144195 NA non-coding upstream 241623 9443656 ~ 9443894 (+)
G144315 glul,gs01,LOC107083392,LOC107732203,LOC106584177,LOC108438877,LOC104941255,LOC108272186,LOC108437688,LOC105011759,LOC107733907,LOC106560331 non-coding downstream 154638 9843429 ~ 9847756 (+)
G144512 NA non-coding downstream 1307591 10996382 ~ 10997606 (+)
G144534 NA non-coding downstream 1446966 11135757 ~ 11139343 (+)
G144549 NA non-coding downstream 1509522 11198313 ~ 11199835 (+)
G144581 btf3l4,bt3l4,LOC107562065,LOC107655993,LOC104965512,LOC103026176 non-coding downstream 1555811 11244602 ~ 11247808 (+)
AMCG00004870 rpf1,LOC107745333 other upstream 1951458 7718273 ~ 7734059 (+)
AMCG00004868 samd13 other upstream 1993156 7672816 ~ 7692361 (+)
AMCG00004864 NA other upstream 2061447 7608901 ~ 7624070 (+)
G143626 NA other upstream 4261396 5423703 ~ 5424121 (+)
G143471 LOC107575789 other upstream 5313428 4371709 ~ 4372089 (+)
AMCG00004921 gbg12,gng12,LOC105895117,LOC107555383,LOC107705318 other downstream 11376 9700167 ~ 9750777 (+)
AMCG00004935 pbx1b,LOC108443834,LOC108272157,LOC106584178,LOC101069707,LOC105011758,LOC106599262 other downstream 259619 9948410 ~ 10015424 (+)
G144677 NA other downstream 1973890 11662681 ~ 11663368 (+)
G144940 NA other downstream 3091789 12780580 ~ 12781170 (+)
AMCG00005060 LOC106599426 other downstream 4466364 14155155 ~ 14188329 (+)

Expression


Co-expression Network