AMCG00005047 (astn1)


Basic Information

Item Value
gene id AMCG00005047
gene name astn1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 13739454 ~ 13744629 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005047
ATGGTGAATTACAGTGAAGTGTCTGGCTACCCCTTGGTTCAGAAATGGAAGCTGAGATCCATTTTGTACCACGTCAAGCTCAATCAGTGGGCGCTTTCCCAAGCATTCAGCGCTGCCATCCACTCTCTGGACGGAGCGACTCTCCGGAGCGACTTCGTATCAATCCTGAAGGAGTTCGGGAACCACTTTATCCAAGAGGCTGTGTACGGGTTCGAGGAATCCTGTAATATCTGGTACCCCAATAAACAAGTCCAGAGGCAGCTGTGGGTGGAGTACCAGGATATCAGCAAA

Function

symbol description
astn1 Predicted to be involved in neuron cell-cell adhesion and neuron migration. Predicted to be located in membrane. Predicted to be active in endosome. Predicted to be integral component of membrane. Used to study schizophrenia. Orthologous to human ASTN1 (astrotactin 1).

NR:

description
PREDICTED: astrotactin-1 isoform X5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005047 True 291 mRNA 0.51 2 13739454 13744629

Neighbor

gene id symbol gene type direction distance location
AMCG00005049 astn1 coding downstream 28972 13705226 ~ 13710482 (-)
AMCG00005044 LOC100380755 coding downstream 54745 13672743 ~ 13684709 (-)
AMCG00005045 rfwd2 coding downstream 137650 13581461 ~ 13601804 (-)
AMCG00005048 NA coding downstream 310168 13391709 ~ 13429286 (-)
AMCG00005042 NA coding downstream 372191 13366931 ~ 13367263 (-)
AMCG00005046 astn1 coding upstream 59378 13804007 ~ 13830346 (-)
AMCG00005055 LOC104960769 coding upstream 306075 14050704 ~ 14061662 (-)
AMCG00005056 klhl20 coding upstream 322069 14066698 ~ 14075633 (-)
AMCG00005054 NA coding upstream 337829 14082458 ~ 14089340 (-)
AMCG00005064 NA coding upstream 646607 14391236 ~ 14395883 (-)
G145031 NA non-coding downstream 480593 13257922 ~ 13258861 (-)
G144954 NA non-coding downstream 923936 12812977 ~ 12815518 (-)
G144941 NA non-coding downstream 958284 12780573 ~ 12781170 (-)
G144920 NA non-coding downstream 1123504 12615715 ~ 12615950 (-)
G144893 NA non-coding downstream 1370986 12367423 ~ 12368468 (-)
G145129 NA non-coding upstream 317092 14061721 ~ 14062111 (-)
G145130 NA non-coding upstream 317715 14062344 ~ 14062624 (-)
G145131 NA non-coding upstream 318236 14062865 ~ 14063123 (-)
G145138 NA non-coding upstream 412951 14157580 ~ 14161976 (-)
G145146 NA non-coding upstream 435475 14180104 ~ 14183513 (-)
G145046 NA other downstream 402708 13336209 ~ 13336746 (-)
AMCG00005022 NA other downstream 1391126 12344671 ~ 12348328 (-)
AMCG00005011 best4,LOC103396708 other downstream 1583076 12135378 ~ 12156378 (-)
G144115 LOC108413222,LOC107749977,LOC107730703,LOC107698886,LOC107675437,LOC107564626 other downstream 4832860 8872885 ~ 8906594 (-)
AMCG00004894 kat3,kyat3,ccbl2,LOC100332215 other downstream 4891679 8836360 ~ 8847775 (-)
AMCG00005077 arpc5,arpc5b,LOC103032016,LOC108431159,LOC107698380,LOC104921830 other upstream 1219785 14964414 ~ 14969242 (-)
AMCG00005111 NA other upstream 1758453 15503082 ~ 15535145 (-)
AMCG00005114 tmem56,LOC107712816,LOC107677262,LOC107657764,LOC106578492,LOC106570700,LOC102779182 other upstream 2214075 15958704 ~ 15978855 (-)
AMCG00005158 NA other upstream 3798517 17543146 ~ 17546332 (-)
AMCG00005207 LOC107384419,LOC103139997,LOC107082609 other upstream 4997255 18741884 ~ 18764298 (-)

Expression


Co-expression Network