AMCG00005193


Basic Information

Item Value
gene id AMCG00005193
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 18542551 ~ 18545413 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005193
ATGAAGCATCGATTTGGGATTCTTCTTCAGAAACCAGATGCGATGCTGGATCAGAGTAATGTCAGCAACAAGAAAGAGAAAGCTTCTGGAGGGAAGAAGATCTGTCCGACTGAAGTCAAGAAATGGGGAGAGTCGTTGGAGAACCTGCTGAACAACGAAGTTGGCCTGGCCGCTTTTACAACTTTCCTGAAGTCGGAGTTCAGCGAGGAGAACATCGAGTTCTGGGCGAGCTGCGAGGAATACAAGAGGACCATGTCTCAGACCAAACGGGCAGCTAAAGCGAAGAAGATCTACGAGCAGTACGTCGCCGTGGAATCTGAGAAAGAGGTTAACCTTGATTCCTCGACTAGAGAAGAGACCAAGAGGAACCTTGAAGACCCCACAGCCTCCTCCTTCGACGAAGCCCAGCGGAAGATCTTTCTGCTGATGGAGAAGGACTCTTACCGGCGTTTCTTGAAATCAAAGACTTACCGAGACTTACTCCAGCACCCTGGGAGCAGCGGCACCTGTAGCGCGGAGAAGAGAGGGAAGGGACACGTGTCTGAGTTCAACCAGCTGCTTCCACTGTGTGCCTAA

Function

GO: NA

KEGG:

id description
K16449 RGS; regulator of G-protein signaling

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005193 True 576 mRNA 0.51 4 18542551 18545413

Neighbor

gene id symbol gene type direction distance location
AMCG00005178 NA coding downstream 433098 18103258 ~ 18109453 (-)
AMCG00005179 NA coding downstream 453436 18087405 ~ 18089115 (-)
AMCG00005186 NA coding downstream 468628 18070432 ~ 18073923 (-)
AMCG00005187 NA coding downstream 476183 18063829 ~ 18066368 (-)
AMCG00005183 NA coding downstream 493307 18046691 ~ 18049244 (-)
AMCG00005196 NA coding upstream 133653 18679066 ~ 18684796 (-)
AMCG00005209 NA coding upstream 188547 18733960 ~ 18738143 (-)
AMCG00005208 NA coding upstream 230055 18775468 ~ 18781565 (-)
AMCG00005202 NA coding upstream 261658 18807071 ~ 18813335 (-)
AMCG00005200 tctex1d1 coding upstream 281573 18826986 ~ 18830395 (-)
G146023 NA non-coding downstream 190419 18351867 ~ 18352132 (-)
G146022 NA non-coding downstream 244448 18297847 ~ 18298103 (-)
G145995 NA non-coding downstream 516877 18024765 ~ 18025674 (-)
G145760 NA non-coding downstream 1577477 16964203 ~ 16965074 (-)
G145680 LOC101077364,LOC107383562,LOC104957225 non-coding downstream 2167134 16374662 ~ 16375417 (-)
G146189 NA non-coding upstream 538582 19083995 ~ 19086041 (-)
G146227 NA non-coding upstream 672978 19218391 ~ 19219758 (-)
G146257 NA non-coding upstream 918594 19464007 ~ 19464975 (-)
G146315 NA non-coding upstream 1065353 19610766 ~ 19611005 (-)
G146322 NA non-coding upstream 1158591 19704004 ~ 19732117 (-)
AMCG00005158 NA other downstream 996219 17543146 ~ 17546332 (-)
AMCG00005114 tmem56,LOC107712816,LOC107677262,LOC107657764,LOC106578492,LOC106570700,LOC102779182 other downstream 2563696 15958704 ~ 15978855 (-)
AMCG00005111 NA other downstream 3007406 15503082 ~ 15535145 (-)
AMCG00005077 arpc5,arpc5b,LOC103032016,LOC108431159,LOC107698380,LOC104921830 other downstream 3573309 14964414 ~ 14969242 (-)
G145046 NA other downstream 5205805 13336209 ~ 13336746 (-)
AMCG00005207 LOC107384419,LOC103139997,LOC107082609 other upstream 196471 18741884 ~ 18764298 (-)
AMCG00005214 NA other upstream 467664 19013077 ~ 19024461 (-)
G146313 NA other upstream 1024646 19570059 ~ 19573318 (-)
AMCG00005240 NA other upstream 1212819 19758232 ~ 19761446 (-)
AMCG00005256 cpt2,clg17h1orf123,c20h1orf123,cunh1orf123,LOC107668114,LOC107585892,LOC107695271,LOC108441638,LOC107549124,LOC105891296,LOC105925314,LOC106930840,LOC103363808 other upstream 1453754 19999167 ~ 20023507 (-)

Expression


Co-expression Network