AMCG00005194 (nos1ap,LOC107692421,LOC107711121,LOC107551033)


Basic Information

Item Value
gene id AMCG00005194
gene name nos1ap,LOC107692421,LOC107711121,LOC107551033
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 18630414 ~ 18635052 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005194
ATATTCTATGTGTCTCATGACTCCCAGGACTTGAAAATTTTCAGCTACATTGCAAGGGACGGGCAAAGCAATGTGTTCCGCTGTAATGTCTTCAAATCGAAGAAAAAGAGTCAAGCCATGAGGATCGTACGGACGGTGGGCCAGGCCTTCGAAGTCTGTCACAAGCTCAGCCTGCAGCACACGCAGCAGAACGCGGACGGACAGGAGGACGGGGACAGCGAGAAGAACAGCGACGACTCGGGGGTGCCAGCGCGCCAGCTGACGGGTGCGGAGAAGACCGTGGCGGAGGAGACGGATATCGACGCGGAGGAAGTCCCCTTACCCGACAGCACGATTGATGAGTTTAACCGCGGGGTCACAGACCTGGACGCGGCCAAGAAGGAACAAGACATTAGTAAAGAGAAC

Function

symbol description
nos1ap Predicted to enable nitric-oxide synthase binding activity. Involved in postsynaptic actin cytoskeleton organization; regulation of heart rate by chemical signal; and regulation of ventricular cardiac muscle cell membrane repolarization. Is active in glutamatergic synapse. Implicated in nephrotic syndrome type 22.

NR:

description
PREDICTED: carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase protein-like isoform X1

GO: NA

KEGG:

id description
K16513 NOS1AP, CAPON; carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase protein

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005194 True 405 mRNA 0.56 3 18630414 18635052

Neighbor

gene id symbol gene type direction distance location
AMCG00005192 rgs5a,LOC107732440,LOC108441543,LOC107083032,LOC107564083 coding upstream 94187 18526096 ~ 18536227 (+)
AMCG00005191 NA coding upstream 122698 18504886 ~ 18507716 (+)
AMCG00005190 NA coding upstream 149494 18473181 ~ 18480920 (+)
AMCG00005189 LOC107711117,LOC108441513 coding upstream 211833 18401193 ~ 18418581 (+)
AMCG00005180 brinp3a.2,LOC105906059,LOC106560299,LOC107711116,LOC107732449,LOC108440126,LOC105024861,LOC107667973 coding upstream 408866 18202351 ~ 18221548 (+)
AMCG00005195 nos1ap,LOC107711121,LOC107551033,LOC107692421,LOC108271954 coding downstream 10393 18645445 ~ 18664265 (+)
AMCG00005206 uap1,LOC106584139 coding downstream 49156 18684208 ~ 18695706 (+)
AMCG00005205 ddr2,ddr2a,LOC106584138,LOC106560289 coding downstream 78353 18713405 ~ 18726215 (+)
AMCG00005204 NA coding downstream 93653 18728705 ~ 18733928 (+)
AMCG00005203 serbp1a,LOC107724138,LOC107551037,LOC102797140,LOC107684131 coding downstream 106940 18741992 ~ 18753590 (+)
G146043 NA non-coding upstream 87574 18541256 ~ 18542840 (+)
G146021 NA non-coding upstream 332311 18297874 ~ 18298103 (+)
G145975 NA non-coding upstream 558639 18020892 ~ 18071775 (+)
G145960 NA non-coding upstream 770779 17859136 ~ 17859635 (+)
G145925 NA non-coding upstream 867955 17729788 ~ 17762459 (+)
G146088 NA non-coding downstream 121023 18756075 ~ 18756595 (+)
G146090 NA non-coding downstream 122615 18757667 ~ 18757871 (+)
G146091 NA non-coding downstream 128991 18764043 ~ 18764298 (+)
G146140 NA non-coding downstream 258015 18893067 ~ 18896727 (+)
G146172 NA non-coding downstream 413496 19048548 ~ 19053126 (+)
G145932 NA other upstream 858889 17765257 ~ 17771525 (+)
AMCG00005105 LOC102220226,LOC108442892 other upstream 3245603 15379599 ~ 15384811 (+)
AMCG00005060 LOC106599426 other upstream 4442085 14155155 ~ 14188329 (+)
G144940 NA other upstream 5849244 12780580 ~ 12781170 (+)
G144677 NA other upstream 6967046 11662681 ~ 11663368 (+)
AMCG00005199 wdr78 other downstream 179977 18815029 ~ 18821642 (+)
AMCG00005232 dock7 other downstream 840087 19475139 ~ 19530453 (+)
G146305 NA other downstream 944521 19579573 ~ 19579807 (+)
G146519 NA other downstream 1547302 20182354 ~ 20184643 (+)
AMCG00005272 mast2 other downstream 1617957 20253009 ~ 20279786 (+)

Expression


Co-expression Network