AMCG00005287 (si:ch211-121a2.4,LOC107687197,LOC107581514,LOC103033168,LOC108416079,LOC107712847)


Basic Information

Item Value
gene id AMCG00005287
gene name si:ch211-121a2.4,LOC107687197,LOC107581514,LOC103033168,LOC108416079,LOC107712847
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 20741178 ~ 20742301 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005287
ATGTCCGCTCTGGGGGCCATCATGCCCACCGACCGGGAGCCCACCATGACCGCCAAACTCCTGCACCTCGTCTTCCTCTCCACCTTCTGGGGCATGCAGATCTGGGTCACCTTCATCTCAGGCTTCGTGATGGACAACAACCTGAACAGACACACCTTCGGCTACATCCAGAGCCGTCTCTTCCCTTTCTACTTCCACATGGGATCCGCCTGCGCCTTCTTCAACCTCACCATCTTCACCATGTACCACCCCAGCGACCTGCTGGACGACAGGGAGGCCTTCCAGGTCTTCATCTTCTTCGTGTGTGTGACGGTGGCGGCGGTCAACGCGCAGTGGTTCGGCCAGATGACGTCGGAGATCATGGCGGACATGCACCAGATCGAGCAGGCGTGCGGCCTGGGCCAGGACATCGGGCTCTCGTCCAACCGCGAGGCCTACAGCAAGCTGCGTGAGTCCGACGCCCGGTACCGGAAGCTGAGCAGCCGCCTGTGGCTCTACCACTCGCTGTCCTCGCTGTGCAACCTGTGCTGCATCGGCTGCAACGGGCTGAGCCTCTACTACCTGGCCGAGAACATGACCACCCTATAA

Function

symbol description
si:ch211-121a2.4 Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human TMEM205 (transmembrane protein 205).

NR:

description
PREDICTED: transmembrane protein 205-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005287 True 588 mRNA 0.61 3 20741178 20742301

Neighbor

gene id symbol gene type direction distance location
AMCG00005279 NA coding upstream 113247 20597743 ~ 20627931 (+)
AMCG00005278 NA coding upstream 145424 20589746 ~ 20595754 (+)
AMCG00005274 NA coding upstream 251514 20484932 ~ 20489664 (+)
AMCG00005273 mast2 coding upstream 531721 20208791 ~ 20209457 (+)
AMCG00005260 NA coding upstream 565847 20172733 ~ 20175331 (+)
AMCG00005288 NA coding downstream 21331 20763632 ~ 20768980 (+)
AMCG00005282 NA coding downstream 39007 20781308 ~ 20794020 (+)
AMCG00005281 NA coding downstream 61320 20803621 ~ 20806381 (+)
AMCG00005283 NA coding downstream 64900 20807201 ~ 20814750 (+)
AMCG00005284 bloc1s2,LOC107581516,LOC107697361,LOC107712883 coding downstream 108603 20850904 ~ 20854030 (+)
G146599 NA non-coding upstream 2857 20682625 ~ 20738321 (+)
G146591 NA non-coding upstream 28958 20642772 ~ 20712220 (+)
G146590 NA non-coding upstream 85405 20642268 ~ 20655773 (+)
G146544 NA non-coding upstream 408056 20316007 ~ 20333122 (+)
G146486 NA non-coding upstream 631637 20108102 ~ 20109541 (+)
G146640 NA non-coding downstream 8003 20750304 ~ 20750938 (+)
G146701 NA non-coding downstream 113410 20855711 ~ 20855918 (+)
G146703 NA non-coding downstream 124905 20867206 ~ 20867406 (+)
G146749 NA non-coding downstream 321672 21063973 ~ 21064908 (+)
G146782 NA non-coding downstream 584231 21326532 ~ 21328902 (+)
AMCG00005286 NA other upstream 38706 20699486 ~ 20702472 (+)
G146596 NA other upstream 71009 20661926 ~ 20670169 (+)
G146575 LOC103468264,LOC108238356,LOC106512499 other upstream 216359 20521649 ~ 20524819 (+)
AMCG00005272 mast2 other upstream 461392 20253009 ~ 20279786 (+)
G146519 NA other upstream 556535 20182354 ~ 20184643 (+)
AMCG00005280 NA other downstream 55157 20797458 ~ 20803197 (+)
G146790 NA other downstream 595131 21337432 ~ 21340712 (+)
AMCG00005329 ipo13,LOC103463745,LOC105910849 other downstream 824337 21566638 ~ 21572321 (+)
AMCG00005340 ralgps2,LOC106531732 other downstream 938407 21680708 ~ 21704518 (+)
G146952 NA other downstream 1069431 21811732 ~ 21848136 (+)

Expression


Co-expression Network