AMCG00005339 (ralgps2,LOC107581502,LOC107712857)


Basic Information

Item Value
gene id AMCG00005339
gene name ralgps2,LOC107581502,LOC107712857
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 21707342 ~ 21708394 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005339
ATGCATCTCCAGGCTGTGAAGCTGGCTGAGCTGAACAACCTGCACGCGCTGATGGCCGTGGTGTCGGGGCTGCAGAGCGCCCCCATCTTCAGACTCACCAAGACCTGGGCGCTGTTGAGCCGGAAGGACAAGCTGACCTTCGAGAAGCTGGAGTTCATGATGTCCAAGGAGGACAACTACAAGCGCCTGAGGGATTACATCAGCAGCCTGAGCATGACGCCCTGCATCCCCTACCTGGGTAAGAGCCGCGCAGAGCCAGCTGCGTGA

Function

symbol description
ralgps2 Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to act upstream of or within regulation of Ral protein signal transduction and small GTPase mediated signal transduction. Orthologous to human RALGPS2 (Ral GEF with PH domain and SH3 binding motif 2).

NR:

description
PREDICTED: ras-specific guanine nucleotide-releasing factor RalGPS2 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005339 True 267 mRNA 0.60 3 21707342 21708394

Neighbor

gene id symbol gene type direction distance location
AMCG00005322 NA coding upstream 28239 21677587 ~ 21679103 (+)
AMCG00005317 NA coding upstream 40452 21662349 ~ 21666890 (+)
AMCG00005316 LOC107721804,LOC107712838,LOC105910841,LOC107597850,LOC101160230,LOC107581484 coding upstream 54554 21641391 ~ 21652788 (+)
AMCG00005315 NA coding upstream 72175 21630980 ~ 21635167 (+)
AMCG00005314 NA coding upstream 82736 21622078 ~ 21624606 (+)
AMCG00005336 LOC106584283,LOC106613957 coding downstream 14186 21722580 ~ 21727870 (+)
AMCG00005337 NA coding downstream 24987 21733381 ~ 21737650 (+)
AMCG00005338 NA coding downstream 29290 21737684 ~ 21740828 (+)
AMCG00005335 LOC106569412 coding downstream 47793 21756187 ~ 21757882 (+)
AMCG00005344 NA coding downstream 164633 21873027 ~ 21878534 (+)
G146815 NA non-coding upstream 308371 21398676 ~ 21398971 (+)
G146782 NA non-coding upstream 378440 21326532 ~ 21328902 (+)
G146749 NA non-coding upstream 642434 21063973 ~ 21064908 (+)
G146703 NA non-coding upstream 839936 20867206 ~ 20867406 (+)
G146701 NA non-coding upstream 851424 20855711 ~ 20855918 (+)
G146915 NA non-coding downstream 1963 21710357 ~ 21712783 (+)
G146928 NA non-coding downstream 36485 21744879 ~ 21745451 (+)
G147022 NA non-coding downstream 239692 21948086 ~ 21948618 (+)
G147024 NA non-coding downstream 241934 21950328 ~ 21950587 (+)
G147027 NA non-coding downstream 248207 21956601 ~ 21957045 (+)
AMCG00005340 ralgps2,LOC106531732 other upstream 2824 21680708 ~ 21704518 (+)
AMCG00005329 ipo13,LOC103463745,LOC105910849 other upstream 135021 21566638 ~ 21572321 (+)
G146790 NA other upstream 366630 21337432 ~ 21340712 (+)
AMCG00005280 NA other upstream 904145 20797458 ~ 20803197 (+)
AMCG00005286 NA other upstream 1004870 20699486 ~ 20702472 (+)
G146952 NA other downstream 103338 21811732 ~ 21848136 (+)
AMCG00005345 NA other downstream 174805 21883199 ~ 21887568 (+)
G147021 NA other downstream 237164 21945558 ~ 21947991 (+)
G147025 NA other downstream 244175 21952569 ~ 21952882 (+)
G147029 NA other downstream 249046 21957440 ~ 21984144 (+)

Expression


Co-expression Network