AMCG00005352


Basic Information

Item Value
gene id AMCG00005352
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 21959594 ~ 21960501 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005352
ATGGCTCGGCGCATTGCGATCATCGGCGGGGGCAGCTCGGGGCTGGCCTGTGTAAAGTGCTGCCTGGACGAGGGGCTGGAGCCGGTGTGCTTCGAGAGCAGCGAGGACATCGGGGGGCTCTGGAGGTTCAAGGAGACCCCCGAGCCGGACCGGGCCAGTATCTATCACTCTGTCATCATCAACACCTCCAAGGAGAGAATGTGCTTCAGCGACTTCCCGATCCCGGCGCACTTCCCCAACTACATGCACCACTCGCTCATCATGGACTACTTCCGCATGTACGCCGAGCACTTCCAGCTGCTCCCGCACATCCGCTTCCAGACCCGTGTGCGCAGTGTGGAGCAGCGCCCTGACTTCTCTCGCTCGGGGCAGTGGCAGGTGGTCACAGTGGATAGGGAGGGGCGGGAGGAGAGCTCTGTGTTCGATGGCGTGCTGGTCTGCACGGGGCACCACGTCCACCCACACCTGCCCCTCCACGACTTCCCAGGTGAGGAAGACAGGGAATCTCTATCAGCACAAACCTTGCACTAG

Function

GO: NA

KEGG:

id description
ko00260 Glycine, serine and threonine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005352 True 531 mRNA 0.62 3 21959594 21960501

Neighbor

gene id symbol gene type direction distance location
AMCG00005353 NA coding downstream 2653 21937448 ~ 21956941 (-)
AMCG00005354 NA coding downstream 43295 21911879 ~ 21916299 (-)
AMCG00005355 NA coding downstream 49308 21891314 ~ 21910286 (-)
AMCG00005346 suco coding downstream 98163 21845044 ~ 21861431 (-)
AMCG00005347 NA coding downstream 118278 21838826 ~ 21841316 (-)
AMCG00005361 NA coding upstream 22300 21982801 ~ 21995515 (-)
AMCG00005360 NA coding upstream 101232 22061733 ~ 22078827 (-)
AMCG00005359 NA coding upstream 125793 22086294 ~ 22087753 (-)
AMCG00005367 edem3 coding upstream 143641 22104142 ~ 22112254 (-)
AMCG00005369 NA coding upstream 185285 22145786 ~ 22146079 (-)
G146951 NA non-coding downstream 152288 21806980 ~ 21807306 (-)
G146891 NA non-coding downstream 353059 21589996 ~ 21606535 (-)
G146857 NA non-coding downstream 398133 21560049 ~ 21561461 (-)
G146813 NA non-coding downstream 578025 21381306 ~ 21381569 (-)
G146702 NA non-coding downstream 1101792 20857600 ~ 20857802 (-)
G147122 NA non-coding upstream 171765 22132266 ~ 22180932 (-)
G147156 NA non-coding upstream 268698 22229199 ~ 22229991 (-)
G147184 NA non-coding upstream 462488 22422989 ~ 22423230 (-)
G147185 NA non-coding upstream 465224 22425725 ~ 22426106 (-)
AMCG00005343 NA other downstream 211796 21745544 ~ 21747798 (-)
G146938 NA other downstream 214141 21744876 ~ 21745453 (-)
AMCG00005333 NA other downstream 471883 21485949 ~ 21487711 (-)
G146618 NA other downstream 1348951 20609354 ~ 20610643 (-)
AMCG00005276 pomgnt1 other downstream 1457388 20491051 ~ 20502206 (-)
AMCG00005363 NA other upstream 10534 21971035 ~ 21982521 (-)
AMCG00005362 rgl1,LOC107657943,LOC107750730,LOC107717560 other upstream 70324 22030825 ~ 22054967 (-)
G147109 NA other upstream 76094 22036595 ~ 22101862 (-)
G147108 NA other upstream 123216 22083717 ~ 22084944 (-)
G147121 NA other upstream 167406 22127907 ~ 22130549 (-)

Expression


Co-expression Network