G144877 (toe1,LOC107579611)


Basic Information

Item Value
gene id G144877
gene name toe1,LOC107579611
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 12302579 ~ 12302836 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU182205
CACTTCTTGTAGGCGTACTCCAGGTAGGATGCCATGAAGCGCATCTCGTACTCTGAGGCATACTTGGTGTCAAAGACCCCCGCTGGAAACATCTCGGAGAGGTCTGCCGTGAAGGTGGACAGGCGTTCGGGCAGGTGTGCGTAGAAGCACTGGTACAAGAAGACCAGGTCAATCAGCCCATTGTGAAGCACCAGCGGCTTCTTGGCCCGCAGCAGCTCCAGGAACAGCGCCCGCATCGTCTGGCCATGCACATCCCCT

Function

symbol description
toe1 Predicted to enable 3'-5'-exoribonuclease activity and snRNA binding activity. Acts upstream of or within brain development and neuron cellular homeostasis. Predicted to be active in Cajal body and cytoplasm. Used to study pontocerebellar hypoplasia. Human ortholog(s) of this gene implicated in pontocerebellar hypoplasia type 7. Orthologous to human TOE1 (target of EGR1, exonuclease).

NR:

description
target of EGR1 protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU182205 True 258 lncRNA 0.58 1 12302579 12302836

Neighbor

gene id symbol gene type direction distance location
AMCG00005020 NA coding downstream 2070 12298967 ~ 12300509 (-)
AMCG00005017 NA coding downstream 4797 12289910 ~ 12297782 (-)
AMCG00005021 NA coding downstream 14061 12284394 ~ 12288518 (-)
AMCG00005004 zswim5,LOC107602525,LOC107728925,LOC107674240,LOC107714849 coding downstream 103509 12183940 ~ 12199070 (-)
AMCG00005009 hectd3,LOC107688506 coding downstream 130349 12163830 ~ 12172230 (-)
AMCG00005018 NA coding upstream 7515 12310351 ~ 12315652 (-)
AMCG00005019 NA coding upstream 37332 12340168 ~ 12344668 (-)
AMCG00005012 NA coding upstream 141516 12444352 ~ 12454372 (-)
AMCG00005029 NA coding upstream 477435 12780271 ~ 12801667 (-)
AMCG00005026 b4galt2 coding upstream 515774 12818610 ~ 12842175 (-)
G144826 NA non-coding downstream 273130 12023514 ~ 12029449 (-)
G144821 NA non-coding downstream 292208 12009918 ~ 12010371 (-)
G144672 NA non-coding downstream 730169 11571190 ~ 11572410 (-)
G144659 NA non-coding downstream 796577 11505678 ~ 11506002 (-)
G144657 NA non-coding downstream 801504 11499172 ~ 11501075 (-)
G144878 NA non-coding upstream 129 12302965 ~ 12303263 (-)
G144879 NA non-coding upstream 575 12303411 ~ 12303620 (-)
G144880 NA non-coding upstream 1787 12304623 ~ 12304887 (-)
G144893 NA non-coding upstream 64587 12367423 ~ 12368468 (-)
G144920 NA non-coding upstream 312879 12615715 ~ 12615950 (-)
AMCG00005011 best4,LOC103396708 other downstream 146201 12135378 ~ 12156378 (-)
G144115 LOC108413222,LOC107749977,LOC107730703,LOC107698886,LOC107675437,LOC107564626 other downstream 3395985 8872885 ~ 8906594 (-)
AMCG00004894 kat3,kyat3,ccbl2,LOC100332215 other downstream 3454804 8836360 ~ 8847775 (-)
G144050 selenof,LOC106598901 other downstream 3925578 8353989 ~ 8377001 (-)
G143659 NA other downstream 6519395 5736809 ~ 5783184 (-)
AMCG00005022 NA other upstream 41835 12344671 ~ 12348328 (-)
G145046 NA other upstream 1033373 13336209 ~ 13336746 (-)
AMCG00005077 arpc5,arpc5b,LOC103032016,LOC108431159,LOC107698380,LOC104921830 other upstream 2661578 14964414 ~ 14969242 (-)
AMCG00005111 NA other upstream 3200246 15503082 ~ 15535145 (-)
AMCG00005114 tmem56,LOC107712816,LOC107677262,LOC107657764,LOC106578492,LOC106570700,LOC102779182 other upstream 3655868 15958704 ~ 15978855 (-)

Expression


Co-expression Network