AMCG00005796 (prpf8,LOC106612861,LOC100380699,LOC107756948)


Basic Information

Item Value
gene id AMCG00005796
gene name prpf8,LOC106612861,LOC100380699,LOC107756948
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 8818674 ~ 8819107 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005796
ATGGCAGCTGCCTTCCCATACCGAGGGGTGCCAGGGGGGATCCCCACCCCAGGCCAGATCCCTGACTTCATGTCCGAGGAGAAGCTGCAGGAGAAAGCCCGTAAGTGGCAGCAGCTGCAGGCGAAGCGCTATGCGGAGAAGAGGAAGTTCGGCTTCGTGGATGCCCAGAAGGAGGACATGCCACCCGAGCACGTCCGCAAGATCATCAGAGACCACGGCGACATGACCAACAGGAAGTTCCGTCACGACAAGAGGGTCTATCTGGGGTAA

Function

symbol description
prpf8 Predicted to enable pre-mRNA intronic binding activity and snRNA binding activity. Acts upstream of or within spliceosomal tri-snRNP complex assembly. Predicted to be located in nucleus. Predicted to be part of U5 snRNP and catalytic step 2 spliceosome. Is expressed in brain. Human ortholog(s) of this gene implicated in retinitis pigmentosa and retinitis pigmentosa 13. Orthologous to human PRPF8 (pre-mRNA processing factor 8).

NR:

description
PREDICTED: pre-mRNA-processing-splicing factor 8-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005796 True 270 mRNA 0.60 2 8818674 8819107

Neighbor

gene id symbol gene type direction distance location
AMCG00005793 prpf8,LOC102787788 coding downstream 228 8805151 ~ 8818446 (-)
AMCG00005794 NA coding downstream 16517 8796310 ~ 8802157 (-)
AMCG00005792 NA coding downstream 25799 8786806 ~ 8792875 (-)
AMCG00005795 NA coding downstream 32153 8776856 ~ 8786521 (-)
AMCG00005760 NA coding downstream 47806 8764511 ~ 8770868 (-)
AMCG00005797 NA coding upstream 2436 8821543 ~ 8824036 (-)
AMCG00005743 LOC106523455 coding upstream 66989 8886096 ~ 8895315 (-)
AMCG00005744 NA coding upstream 87304 8906411 ~ 8933458 (-)
AMCG00005748 NA coding upstream 208022 9027129 ~ 9030678 (-)
AMCG00005747 LOC107744803 coding upstream 224024 9043131 ~ 9053426 (-)
G154010 NA non-coding downstream 88525 8729803 ~ 8730149 (-)
G153980 NA non-coding downstream 230452 8574192 ~ 8588222 (-)
G153779 NA non-coding downstream 797034 7984240 ~ 8021640 (-)
G153778 cct6a non-coding downstream 834743 7982030 ~ 7983931 (-)
G153742 NA non-coding downstream 943632 7874787 ~ 7875042 (-)
G154126 NA non-coding upstream 168174 8987281 ~ 9024879 (-)
G154150 NA non-coding upstream 276564 9095671 ~ 9108363 (-)
G154157 blmh,LOC106612652 non-coding upstream 309663 9128770 ~ 9139826 (-)
G154234 git1 non-coding upstream 506415 9325522 ~ 9330533 (-)
G154235 NA non-coding upstream 512236 9331343 ~ 9332033 (-)
G153806 NA other downstream 693989 8091748 ~ 8124685 (-)
AMCG00005704 NA other downstream 817269 7999336 ~ 8001405 (-)
G153733 auts2 other downstream 1030353 7785554 ~ 7788321 (-)
AMCG00005685 NA other downstream 1672867 7109218 ~ 7145807 (-)
AMCG00005674 NA other downstream 2322103 6490255 ~ 6496571 (-)
G154142 NA other upstream 271315 9090422 ~ 9092573 (-)
G154250 NA other upstream 606183 9425290 ~ 9434940 (-)
AMCG00005850 NA other upstream 1476492 10295599 ~ 10352782 (-)
AMCG00005862 NA other upstream 1724427 10543534 ~ 10551355 (-)
AMCG00005839 LOC103367321,LOC107729686,LOC103398303 other upstream 1919437 10738544 ~ 10752114 (-)

Expression


Co-expression Network